Directory Listing of /cnidarian/skitch/

Folder..   
-_Google_Sheets_1B20DC68.png-_Google_Sheets_1B20DC68.png 81KB Jun 04 2015 12:20:09 PM-_Google_Sheets_1B20DC68.png
-_Google_Sheets_1B20DCDF.png-_Google_Sheets_1B20DCDF.png 44KB Jun 04 2015 12:22:08 PM-_Google_Sheets_1B20DCDF.png
-_Google_Sheets_1B20DD3F.png-_Google_Sheets_1B20DD3F.png 44KB Jun 04 2015 12:23:44 PM-_Google_Sheets_1B20DD3F.png
-_Google_Sheets_1B20DD89.png-_Google_Sheets_1B20DD89.png 42KB Jun 04 2015 12:24:58 PM-_Google_Sheets_1B20DD89.png
-_Google_Sheets_1B20DDEF.png-_Google_Sheets_1B20DDEF.png 13KB Jun 04 2015 12:26:40 PM-_Google_Sheets_1B20DDEF.png
0-25%_meth_17CEA9F1.png0-25%_meth_17CEA9F1.png 189KB Aug 28 2013 03:06:17 PM0-25%_meth_17CEA9F1.png
0-25%_meth_17CEAA21.png0-25%_meth_17CEAA21.png 189KB Aug 28 2013 03:07:02 PM0-25%_meth_17CEAA21.png
0-25meth_17CEAA3D.png0-25meth_17CEAA3D.png 189KB Aug 28 2013 03:07:37 PM0-25meth_17CEAA3D.png
01-Bash-Intro_1D9ED045.png01-Bash-Intro_1D9ED045.png 518KB Sep 30 2016 09:54:32 AM01-Bash-Intro_1D9ED045.png
001_1-Downloading-databases_1DC23B8E.png001_1-Downloading-databases_1DC23B8E.png 179KB Oct 27 2016 06:41:35 AM001_1-Downloading-databases_1DC23B8E.png
001_1-Downloading-databases_1DC23B63.png001_1-Downloading-databases_1DC23B63.png 197KB Oct 27 2016 06:40:52 AM001_1-Downloading-databases_1DC23B63.png
001_1-Downloading-databases_1DC23BB7.png001_1-Downloading-databases_1DC23BB7.png 62KB Oct 27 2016 06:42:16 AM001_1-Downloading-databases_1DC23BB7.png
001_1-Downloading-databases_1DC23BF1.png001_1-Downloading-databases_1DC23BF1.png 167KB Oct 27 2016 06:43:14 AM001_1-Downloading-databases_1DC23BF1.png
001_1-Downloading-databases_1DC23C18.png001_1-Downloading-databases_1DC23C18.png 518KB Oct 27 2016 06:43:53 AM001_1-Downloading-databases_1DC23C18.png
01_2-Geo-Trans-annotation_1BF64666.png01_2-Geo-Trans-annotation_1BF64666.png 47KB Nov 13 2015 08:25:12 AM01_2-Geo-Trans-annotation_1BF64666.png
01_2-Geo-Trans-annotation_1D95D620.png01_2-Geo-Trans-annotation_1D95D620.png 44KB Sep 23 2016 02:29:07 PM01_2-Geo-Trans-annotation_1D95D620.png
01_2_1-Geo-Trans-MasterTable_1D95D66A.png01_2_1-Geo-Trans-MasterTable_1D95D66A.png 104KB Sep 23 2016 02:30:19 PM01_2_1-Geo-Trans-MasterTable_1D95D66A.png
01_2_1-Geo-Trans-MasterTable_1D95D986.png01_2_1-Geo-Trans-MasterTable_1D95D986.png 113KB Sep 23 2016 02:43:37 PM01_2_1-Geo-Trans-MasterTable_1D95D986.png
2boxes_1B7AA416.png2boxes_1B7AA416.png 354KB Aug 11 2015 02:43:50 PM2boxes_1B7AA416.png
2bRAD_Dec2015_and_MBD_BSseq_December_2015_·_RobertsLab_project-olympia_oyster-genomic_Wiki_and_sr320_student-fish546-2016_and_sr320_—_bash_—_126×14_1DDA0797.png2bRAD_Dec2015_and_MBD_BSseq_December_201... 499KB Nov 14 2016 06:54:17 AM2bRAD_Dec2015_and_MBD_BSseq_December_2015_·_RobertsLab_project-olympia_oyster-genomic_Wiki_and_sr320_student-fish546-2016_and_sr320_—_bash_—_126×14_1DDA0797.png
03-Mapping-2bRAD_1DDA1E14.png03-Mapping-2bRAD_1DDA1E14.png 144KB Nov 14 2016 08:30:13 AM03-Mapping-2bRAD_1DDA1E14.png
03-Mapping-2bRAD_and_Google_Hangouts_-_roberts_sbr_gmail_com_1DD7B76E.png03-Mapping-2bRAD_and_Google_Hangouts_-_r... 460KB Nov 12 2016 12:47:42 PM03-Mapping-2bRAD_and_Google_Hangouts_-_roberts_sbr_gmail_com_1DD7B76E.png
0003_1D131D93.png0003_1D131D93.png 61KB Jun 16 2016 10:47:03 AM0003_1D131D93.png
03_5-Mapping-GBS_1DF09297.png03_5-Mapping-GBS_1DF09297.png 156KB Dec 01 2016 09:17:12 AM03_5-Mapping-GBS_1DF09297.png
3_selected_items_-_Protein_-_NCBI_19806EA2.png3_selected_items_-_Protein_-_NCBI_19806E... 86KB Jul 23 2014 03:28:51 PM3_selected_items_-_Protein_-_NCBI_19806EA2.png
0005_1D131CE3.png0005_1D131CE3.png 40KB Jun 16 2016 10:44:09 AM0005_1D131CE3.png
8_ACTTGA_L001_R1_001_fastq_FastQC_Report_1C50546C.png8_ACTTGA_L001_R1_001_fastq_FastQC_Report... 36KB Jan 20 2016 03:49:02 PM8_ACTTGA_L001_R1_001_fastq_FastQC_Report_1C50546C.png
11-Exploring-the-Big-Table_and_SQLShare_-_View_Query_1DC0E388.png11-Exploring-the-Big-Table_and_SQLShare_... 227KB Oct 26 2016 06:13:45 AM11-Exploring-the-Big-Table_and_SQLShare_-_View_Query_1DC0E388.png
20-d10-DMLs_1EF46310.png20-d10-DMLs_1EF46310.png 98KB Jun 16 2017 12:03:46 PM20-d10-DMLs_1EF46310.png
75up_17CEA940.png75up_17CEA940.png 196KB Aug 28 2013 03:03:19 PM75up_17CEA940.png
400mc_17F07AC5.png400mc_17F07AC5.png 97KB Sep 23 2013 06:33:59 AM400mc_17F07AC5.png
546-Bioinformatics_09_Visualizing_with_IGV__ipynb_at_master_·_laurahspencer_546-Bioinformatics_1E08352A.png546-Bioinformatics_09_Visualizing_with_I... 218KB Dec 19 2016 07:32:59 AM546-Bioinformatics_09_Visualizing_with_IGV__ipynb_at_master_·_laurahspencer_546-Bioinformatics_1E08352A.png
2013-11-02_12.28.38.jpg_and_Camera_Uploads_and_Photos_-_Google__182FF6D8.png2013-11-02_12.28.38.jpg_and_Camera_Uploa... 1208KB Nov 10 2013 09:17:27 AM2013-11-02_12.28.38.jpg_and_Camera_Uploads_and_Photos_-_Google__182FF6D8.png
2014-01-13 07.51.02.jpg2014-01-13 07.51.02.jpg 2395KB Jan 13 2014 07:51:02 AM2014-01-13 07.51.02.jpg
2014-01-13 07.51.11.jpg2014-01-13 07.51.11.jpg 2284KB Jan 13 2014 07:51:11 AM2014-01-13 07.51.11.jpg
2014-01-13 07.54.34.jpg2014-01-13 07.54.34.jpg 2247KB Jan 13 2014 07:54:34 AM2014-01-13 07.54.34.jpg
2014-01-13 07.54.40.jpg2014-01-13 07.54.40.jpg 2244KB Jan 13 2014 07:54:40 AM2014-01-13 07.54.40.jpg
2014-01-13 07.57.59.jpg2014-01-13 07.57.59.jpg 2267KB Jan 13 2014 07:57:59 AM2014-01-13 07.57.59.jpg
2014-01-13 07.58.53.jpg2014-01-13 07.58.53.jpg 2440KB Jan 13 2014 07:58:53 AM2014-01-13 07.58.53.jpg
2014-01-13 07.59.08.jpg2014-01-13 07.59.08.jpg 2335KB Jan 13 2014 07:59:08 AM2014-01-13 07.59.08.jpg
2014-01-13 08.23.24.jpg2014-01-13 08.23.24.jpg 2333KB Jan 13 2014 08:23:24 AM2014-01-13 08.23.24.jpg
2014-01-13 08.26.18.jpg2014-01-13 08.26.18.jpg 2199KB Jan 13 2014 08:26:18 AM2014-01-13 08.26.18.jpg
2014-01-13 08.33.32.jpg2014-01-13 08.33.32.jpg 2155KB Jan 13 2014 08:33:32 AM2014-01-13 08.33.32.jpg
2014-01-13 08.35.47.jpg2014-01-13 08.35.47.jpg 2071KB Jan 13 2014 08:35:47 AM2014-01-13 08.35.47.jpg
2014-01-13 09.26.30.jpg2014-01-13 09.26.30.jpg 1927KB Jan 13 2014 09:26:30 AM2014-01-13 09.26.30.jpg
2014-01-13 13.08.53.jpg2014-01-13 13.08.53.jpg 973KB Jan 13 2014 01:08:53 PM2014-01-13 13.08.53.jpg
2014-01-13_07_51_02_jpg_188EA296.png2014-01-13_07_51_02_jpg_188EA296.png 927KB Jan 21 2014 04:43:09 AM2014-01-13_07_51_02_jpg_188EA296.png
2014-01-13_07_54_34_jpg_188EA2F1.png2014-01-13_07_54_34_jpg_188EA2F1.png 500KB Jan 21 2014 04:44:39 AM2014-01-13_07_54_34_jpg_188EA2F1.png
2014-01-13_07_57_59_jpg_and_2014-01-13_07_54_40_jpg_188EA3BF.png2014-01-13_07_57_59_jpg_and_2014-01-13_0... 444KB Jan 21 2014 04:48:06 AM2014-01-13_07_57_59_jpg_and_2014-01-13_07_54_40_jpg_188EA3BF.png
2014-01-13_07_58_53_jpg_and_2014-01-13_07_57_59_jpg_188EA41C.png2014-01-13_07_58_53_jpg_and_2014-01-13_0... 506KB Jan 21 2014 04:49:39 AM2014-01-13_07_58_53_jpg_and_2014-01-13_07_57_59_jpg_188EA41C.png
2014-01-13_08_23_24_jpg_188EA58C.png2014-01-13_08_23_24_jpg_188EA58C.png 511KB Jan 21 2014 04:55:48 AM2014-01-13_08_23_24_jpg_188EA58C.png
2014-01-13_08_23_24_jpg_188EA594.png2014-01-13_08_23_24_jpg_188EA594.png 511KB Jan 21 2014 04:55:56 AM2014-01-13_08_23_24_jpg_188EA594.png
2014-01-13_13_08_56_jpg_188DF4CA.png2014-01-13_13_08_56_jpg_188DF4CA.png 729KB Jan 20 2014 04:21:50 PM2014-01-13_13_08_56_jpg_188DF4CA.png
2014-01-13_13_08_56_jpg_188DF4DF.png2014-01-13_13_08_56_jpg_188DF4DF.png 729KB Jan 20 2014 04:22:03 PM2014-01-13_13_08_56_jpg_188DF4DF.png
2014-10-22_13_54_26_jpg_1A00109C.png2014-10-22_13_54_26_jpg_1A00109C.png 1283KB Oct 28 2014 10:57:49 AM2014-10-22_13_54_26_jpg_1A00109C.png
2014-11-26_15_00_52_jpg__4_documents__4_total_pages__1A269582.png2014-11-26_15_00_52_jpg__4_documents__4_... 1627KB Nov 26 2014 03:11:00 PM2014-11-26_15_00_52_jpg__4_documents__4_total_pages__1A269582.png
2014-11-26_15_01_20_jpg__4_documents__4_total_pages__and_Camera_Uploads_1A26954E.png2014-11-26_15_01_20_jpg__4_documents__4_... 555KB Nov 26 2014 03:10:07 PM2014-11-26_15_01_20_jpg__4_documents__4_total_pages__and_Camera_Uploads_1A26954E.png
2014-EID-class-photo-1024x680_jpg__1024×680__1B55A5BE.png2014-EID-class-photo-1024x680_jpg__1024... 1017KB Jul 14 2015 01:16:48 PM2014-EID-class-photo-1024x680_jpg__1024×680__1B55A5BE.png
2015-08-11_06_28_24_jpg__3_documents__3_total_pages__1B7A6D1E.png2015-08-11_06_28_24_jpg__3_documents__3_... 886KB Aug 11 2015 10:49:19 AM2015-08-11_06_28_24_jpg__3_documents__3_total_pages__1B7A6D1E.png
2015-08-11_06_31_33_jpg__3_documents__3_total_pages__1B7A6D8E.png2015-08-11_06_31_33_jpg__3_documents__3_... 1507KB Aug 11 2015 10:51:10 AM2015-08-11_06_31_33_jpg__3_documents__3_total_pages__1B7A6D8E.png
2015-08-11_09_35_11_jpg__7_documents__7_total_pages__1B7A6DB8.png2015-08-11_09_35_11_jpg__7_documents__7_... 1468KB Aug 11 2015 10:51:53 AM2015-08-11_09_35_11_jpg__7_documents__7_total_pages__1B7A6DB8.png
2015-08-12_09_18_15_jpg__6_documents__6_total_pages__1B7BDCBF.png2015-08-12_09_18_15_jpg__6_documents__6_... 858KB Aug 12 2015 12:57:52 PM2015-08-12_09_18_15_jpg__6_documents__6_total_pages__1B7BDCBF.png
2015-08-12_12_45_57_jpg__6_documents__6_total_pages__1B7BDD39.png2015-08-12_12_45_57_jpg__6_documents__6_... 1242KB Aug 12 2015 12:59:54 PM2015-08-12_12_45_57_jpg__6_documents__6_total_pages__1B7BDD39.png
2015-08-12_12_49_30_jpg__6_documents__6_total_pages__1B7BDDAA.png2015-08-12_12_49_30_jpg__6_documents__6_... 1942KB Aug 12 2015 01:01:47 PM2015-08-12_12_49_30_jpg__6_documents__6_total_pages__1B7BDDAA.png
2015-FIU-Roberts_key_1AE8624C.png2015-FIU-Roberts_key_1AE8624C.png 303KB Apr 22 2015 04:12:19 PM2015-FIU-Roberts_key_1AE8624C.png
2015-OSU-Roberts_key_1AF7ADD6.png2015-OSU-Roberts_key_1AF7ADD6.png 316KB May 04 2015 06:38:32 AM2015-OSU-Roberts_key_1AF7ADD6.png
2015-OSU-Roberts_key_1AF7AE80.png2015-OSU-Roberts_key_1AF7AE80.png 314KB May 04 2015 06:41:24 AM2015-OSU-Roberts_key_1AF7AE80.png
2016-01-28_09_57_31_jpg_and_2016-01-28_09_57_47_jpg_and_2016-01-28_09_57_57_jpg_1C5BDFC3.png2016-01-28_09_57_31_jpg_and_2016-01-28_0... 984KB Jan 29 2016 09:58:29 AM2016-01-28_09_57_31_jpg_and_2016-01-28_09_57_47_jpg_and_2016-01-28_09_57_57_jpg_1C5BDFC3.png
2016-01-28_13_48_31_jpg_1C5BE226.png2016-01-28_13_48_31_jpg_1C5BE226.png 1019KB Jan 29 2016 10:08:40 AM2016-01-28_13_48_31_jpg_1C5BE226.png
2016-01-28_13_48_31_jpg_1C5BE253.png2016-01-28_13_48_31_jpg_1C5BE253.png 1014KB Jan 29 2016 10:09:24 AM2016-01-28_13_48_31_jpg_1C5BE253.png
2016-02-11_10_54_53_jpg_1C6E5C6A.png2016-02-11_10_54_53_jpg_1C6E5C6A.png 1103KB Feb 12 2016 10:31:07 AM2016-02-11_10_54_53_jpg_1C6E5C6A.png
2016-02-11_13_29_22_jpg_1C6E5D0E.png2016-02-11_13_29_22_jpg_1C6E5D0E.png 1056KB Feb 12 2016 10:33:52 AM2016-02-11_13_29_22_jpg_1C6E5D0E.png
2016-02-11_13_31_39_jpg_1C6E5BDC.png2016-02-11_13_31_39_jpg_1C6E5BDC.png 2795KB Feb 12 2016 10:28:48 AM2016-02-11_13_31_39_jpg_1C6E5BDC.png
2016_Oyster_Seed_experiment_23C_vs__29C_·_RobertsLab_project-pacific_oyster-larvae_Wiki_1E82CD75.png2016_Oyster_Seed_experiment_23C_vs__29C_... 160KB Mar 22 2017 08:19:18 AM2016_Oyster_Seed_experiment_23C_vs__29C_·_RobertsLab_project-pacific_oyster-larvae_Wiki_1E82CD75.png
2017-03-22_REVIGO_treemap_eelgrassproteins_R_1E841472.png2017-03-22_REVIGO_treemap_eelgrassprotei... 67KB Mar 23 2017 07:34:27 AM2017-03-22_REVIGO_treemap_eelgrassproteins_R_1E841472.png
2112_Cv_LSU_fastq_FastQC_Report_1AAA4C5F.png2112_Cv_LSU_fastq_FastQC_Report_1AAA4C5F... 127KB Mar 06 2015 12:58:08 PM2112_Cv_LSU_fastq_FastQC_Report_1AAA4C5F.png
2112_Cv_LSU_fastq_FastQC_Report_1AAA4C8F.png2112_Cv_LSU_fastq_FastQC_Report_1AAA4C8F... 89KB Mar 06 2015 12:58:55 PM2112_Cv_LSU_fastq_FastQC_Report_1AAA4C8F.png
2112_Cv_LSU_truseq-rm_fastq_FastQC_Report_1AADE35D.png2112_Cv_LSU_truseq-rm_fastq_FastQC_Repor... 57KB Mar 09 2015 07:19:11 AM2112_Cv_LSU_truseq-rm_fastq_FastQC_Report_1AADE35D.png
2800m3_17F08D3B.png2800m3_17F08D3B.png 126KB Sep 23 2013 07:52:45 AM2800m3_17F08D3B.png
2800_mech_17F07CB2.png2800_mech_17F07CB2.png 111KB Sep 23 2013 06:42:11 AM2800_mech_17F07CB2.png
12864_2015_1817_MOESM1_ESM_xlsx_and_Putative_hemolymph_proteins_and_sr320_—_bash_—_80×24_1D87257B.png12864_2015_1817_MOESM1_ESM_xlsx_and_Puta... 264KB Sep 12 2016 11:03:44 AM12864_2015_1817_MOESM1_ESM_xlsx_and_Putative_hemolymph_proteins_and_sr320_—_bash_—_80×24_1D87257B.png
20140822_TrayLocations.pdf__1_page__17CE30E9.png20140822_TrayLocations.pdf__1_page__17CE... 103KB Aug 28 2013 06:29:49 AM20140822_TrayLocations.pdf__1_page__17CE30E9.png
20141022-GigasRADdnaConcentrations_-_Google_Sheets_1A018BAE.png20141022-GigasRADdnaConcentrations_-_Goo... 28KB Oct 29 2014 01:55:12 PM20141022-GigasRADdnaConcentrations_-_Google_Sheets_1A018BAE.png
20160203_mbdseq_1CBC45B0.png20160203_mbdseq_1CBC45B0.png 140KB Apr 11 2016 01:50:58 PM20160203_mbdseq_1CBC45B0.png
20160512_F15FTSUSAT0327_genome_survey_pdf_1DB646E9.png20160512_F15FTSUSAT0327_genome_survey_pd... 149KB Oct 18 2016 05:02:52 AM20160512_F15FTSUSAT0327_genome_survey_pdf_1DB646E9.png
20160512_F15FTSUSAT0327_genome_survey_pdf_1DB64928.png20160512_F15FTSUSAT0327_genome_survey_pd... 106KB Oct 18 2016 05:12:27 AM20160512_F15FTSUSAT0327_genome_survey_pdf_1DB64928.png
20160512_F15FTSUSAT0327_genome_survey_pdf_1EF86985.png20160512_F15FTSUSAT0327_genome_survey_pd... 111KB Jun 19 2017 01:20:24 PM20160512_F15FTSUSAT0327_genome_survey_pdf_1EF86985.png
20160512_F15FTSUSAT0328_genome_survey_pdf_1D943FAD.png20160512_F15FTSUSAT0328_genome_survey_pd... 70KB Sep 22 2016 09:34:59 AM20160512_F15FTSUSAT0328_genome_survey_pdf_1D943FAD.png
Accessing_Trinity_on_Publicly_Available_Compute_Resources_·_trinityrnaseq_trinityrnaseq_Wiki_1DBE5204.pngAccessing_Trinity_on_Publicly_Available_... 118KB Oct 24 2016 07:28:21 AMAccessing_Trinity_on_Publicly_Available_Compute_Resources_·_trinityrnaseq_trinityrnaseq_Wiki_1DBE5204.png
Account_18514453.pngAccount_18514453.png 99KB Dec 05 2013 03:31:39 PMAccount_18514453.png
Acid_Test__The_Global_Challenge_of_Ocean_Acidification_-_YouTube_1A0FC769.pngAcid_Test__The_Global_Challenge_of_Ocean... 164KB Nov 09 2014 08:01:48 AMAcid_Test__The_Global_Challenge_of_Ocean_Acidification_-_YouTube_1A0FC769.png
AdaptiveImmuneResponse_1CD14C00.pngAdaptiveImmuneResponse_1CD14C00.png 141KB Apr 27 2016 12:35:30 PMAdaptiveImmuneResponse_1CD14C00.png
Adaptive_immunity_1CD14BB7.pngAdaptive_immunity_1CD14BB7.png 131KB Apr 27 2016 12:34:16 PMAdaptive_immunity_1CD14BB7.png
Adaptive_immunity_1CD14BBB.pngAdaptive_immunity_1CD14BBB.png 131KB Apr 27 2016 12:34:20 PMAdaptive_immunity_1CD14BBB.png
adhajfh_18A6AF5F.pngadhajfh_18A6AF5F.png 337KB Feb 08 2014 10:33:08 AMadhajfh_18A6AF5F.png
AGA_Gavery_2014_poster_B_ppt_195B17CD.pngAGA_Gavery_2014_poster_B_ppt_195B17CD.png 46KB Jun 25 2014 07:44:32 AMAGA_Gavery_2014_poster_B_ppt_195B17CD.png
agencode.pngagencode.png 925KB Jan 20 2014 03:47:10 PMagencode.png
agencode2.pngagencode2.png 744KB Jan 20 2014 03:50:23 PMagencode2.png
agencode3.pngagencode3.png 859KB Jan 20 2014 03:51:48 PMagencode3.png
alt-sp_1B66A0F3.pngalt-sp_1B66A0F3.png 60KB Jul 27 2015 10:25:08 AMalt-sp_1B66A0F3.png
alt-sp_1B66A076.pngalt-sp_1B66A076.png 60KB Jul 27 2015 10:23:05 AMalt-sp_1B66A076.png
Amazon_com__Plantronics__Audio_478_Stereo_USB_Headset__Electronics_1A8D1A38.pngAmazon_com__Plantronics__Audio_478_Stere... 87KB Feb 12 2015 09:28:26 AMAmazon_com__Plantronics__Audio_478_Stereo_USB_Headset__Electronics_1A8D1A38.png
Amazon_com__Sabrent_USB_3_0_to_SATA_External_Hard_Drive_Lay-Flat_Docking_Station_for_2_5_or_3_5in_HDD__SSD__Support_UASP_and_4TB___EC-DFLT___Computers___Accessories_1A8144E9.pngAmazon_com__Sabrent_USB_3_0_to_SATA_Exte... 171KB Feb 03 2015 10:03:22 AMAmazon_com__Sabrent_USB_3_0_to_SATA_External_Hard_Drive_Lay-Flat_Docking_Station_for_2_5_or_3_5in_HDD__SSD__Support_UASP_and_4TB___EC-DFLT___Computers___Accessories_1A8144E9.png
Amazon_com__Western_Digital_Caviar_Green_3_TB_SATA_III_64_MB_Cache_Bare_OEM_Desktop_Hard_Drive_-_WD30EZRX__Computers___Accessories_1A814486.pngAmazon_com__Western_Digital_Caviar_Green... 135KB Feb 03 2015 10:01:43 AMAmazon_com__Western_Digital_Caviar_Green_3_TB_SATA_III_64_MB_Cache_Bare_OEM_Desktop_Hard_Drive_-_WD30EZRX__Computers___Accessories_1A814486.png
analyses_1DAAD1AF.pnganalyses_1DAAD1AF.png 149KB Oct 09 2016 12:27:40 PManalyses_1DAAD1AF.png
analyses_1DAAD361.pnganalyses_1DAAD361.png 113KB Oct 09 2016 12:34:53 PManalyses_1DAAD361.png
analyses_1DAAD378.pnganalyses_1DAAD378.png 113KB Oct 09 2016 12:35:22 PManalyses_1DAAD378.png
Animal_Genome_Size_Database___Results_1AB731E1.pngAnimal_Genome_Size_Database___Results_1A... 332KB Mar 16 2015 08:44:33 AMAnimal_Genome_Size_Database___Results_1AB731E1.png
Annotation_1D4BD5EC.pngAnnotation_1D4BD5EC.png 33KB Jul 29 2016 11:20:31 AMAnnotation_1D4BD5EC.png
Annotation_1D4BD559.pngAnnotation_1D4BD559.png 56KB Jul 29 2016 11:18:05 AMAnnotation_1D4BD559.png
Annotation_download_1D8B1D56.pngAnnotation_download_1D8B1D56.png 251KB Sep 15 2016 11:18:01 AMAnnotation_download_1D8B1D56.png
Annotation_download_1D8B22A4.pngAnnotation_download_1D8B22A4.png 284KB Sep 15 2016 11:40:39 AMAnnotation_download_1D8B22A4.png
Annotation_download_1D8B227B.pngAnnotation_download_1D8B227B.png 294KB Sep 15 2016 11:40:01 AMAnnotation_download_1D8B227B.png
Annotation_download_1D8B2285.pngAnnotation_download_1D8B2285.png 294KB Sep 15 2016 11:40:06 AMAnnotation_download_1D8B2285.png
Anthopleura_elegantissima_copper_zinc_superoxide_dismutase-like_protei_-_Nucleotide_-_NCBI_1848AAE9.pngAnthopleura_elegantissima_copper_zinc_su... 137KB Nov 29 2013 02:58:53 AMAnthopleura_elegantissima_copper_zinc_superoxide_dismutase-like_protei_-_Nucleotide_-_NCBI_1848AAE9.png
aq.pngaq.png 487KB Jan 20 2014 03:53:06 PMaq.png
ARCS_annual_luncheon_-_roberts_sbr_gmail_com_-_Gmail_19E82B6C.pngARCS_annual_luncheon_-_roberts_sbr_gmail... 82KB Oct 10 2014 07:57:49 AMARCS_annual_luncheon_-_roberts_sbr_gmail_com_-_Gmail_19E82B6C.png
Argopecten_irradians_C-type_lectin_3_mRNA__complete_cds_-_Nucleotide_-_NCBI_19806CB2.pngArgopecten_irradians_C-type_lectin_3_mRN... 163KB Jul 23 2014 03:20:35 PMArgopecten_irradians_C-type_lectin_3_mRNA__complete_cds_-_Nucleotide_-_NCBI_19806CB2.png
Array-feature-overlap-02_1AA0D233.pngArray-feature-overlap-02_1AA0D233.png 229KB Feb 27 2015 08:26:28 AMArray-feature-overlap-02_1AA0D233.png
Array-feature-overlap-02_1AA0E9D1.pngArray-feature-overlap-02_1AA0E9D1.png 82KB Feb 27 2015 10:07:14 AMArray-feature-overlap-02_1AA0E9D1.png
Array-feature-overlap-02_1AA0E9D7.pngArray-feature-overlap-02_1AA0E9D7.png 82KB Feb 27 2015 10:07:20 AMArray-feature-overlap-02_1AA0E9D7.png
Array-feature-overlap-02_1AA0EA52.pngArray-feature-overlap-02_1AA0EA52.png 60KB Feb 27 2015 10:09:23 AMArray-feature-overlap-02_1AA0EA52.png
Array-feature-overlap-05_1ACEEE8E.pngArray-feature-overlap-05_1ACEEE8E.png 72KB Apr 03 2015 08:51:42 AMArray-feature-overlap-05_1ACEEE8E.png
Atmosphere_1A43835A.pngAtmosphere_1A43835A.png 31KB Dec 18 2014 01:49:16 PMAtmosphere_1A43835A.png
austral_-_YouTube_1A571F35.pngaustral_-_YouTube_1A571F35.png 245KB Jan 02 2015 10:47:18 AMaustral_-_YouTube_1A571F35.png
Author_Area_1E2729E9.pngAuthor_Area_1E2729E9.png 96KB Jan 11 2017 07:05:14 PMAuthor_Area_1E2729E9.png
AVTECH_-_GoToMyDevices_com_-_Manage_Room_Alert_Devices____Anywhere____Anytime__1ECA63E1.pngAVTECH_-_GoToMyDevices_com_-_Manage_Room... 31KB May 15 2017 03:32:03 PMAVTECH_-_GoToMyDevices_com_-_Manage_Room_Alert_Devices____Anywhere____Anytime__1ECA63E1.png
AVTECH_-_GoToMyDevices_com_-_Manage_Room_Alert_Devices____Anywhere____Anytime__1ECA645A.pngAVTECH_-_GoToMyDevices_com_-_Manage_Room... 32KB May 15 2017 03:34:03 PMAVTECH_-_GoToMyDevices_com_-_Manage_Room_Alert_Devices____Anywhere____Anytime__1ECA645A.png
AVTECH_-_GoToMyDevices_com_-_Manage_Room_Alert_Devices____Anywhere____Anytime__1ECA6419.pngAVTECH_-_GoToMyDevices_com_-_Manage_Room... 32KB May 15 2017 03:32:58 PMAVTECH_-_GoToMyDevices_com_-_Manage_Room_Alert_Devices____Anywhere____Anytime__1ECA6419.png
Babraham_Bioinformatics_-_FastQC_A_Quality_Control_tool_for_High_Throughput_Sequence_Data_and_Applications_1BDC32BB.pngBabraham_Bioinformatics_-_FastQC_A_Quali... 61KB Oct 24 2015 02:42:23 PMBabraham_Bioinformatics_-_FastQC_A_Quality_Control_tool_for_High_Throughput_Sequence_Data_and_Applications_1BDC32BB.png
Babraham_Bioinformatics_-_FastQC_A_Quality_Control_tool_for_High_Throughput_Sequence_Data_and_Applications_1BDC32CD.pngBabraham_Bioinformatics_-_FastQC_A_Quali... 61KB Oct 24 2015 02:42:39 PMBabraham_Bioinformatics_-_FastQC_A_Quality_Control_tool_for_High_Throughput_Sequence_Data_and_Applications_1BDC32CD.png
Banners_and_Alerts_1B651CE0.pngBanners_and_Alerts_1B651CE0.png 739KB Jul 26 2015 06:49:23 AMBanners_and_Alerts_1B651CE0.png
Banners_and_Alerts_1B651F19.pngBanners_and_Alerts_1B651F19.png 360KB Jul 26 2015 06:58:53 AMBanners_and_Alerts_1B651F19.png
Banners_and_Alerts_1B6520BE.pngBanners_and_Alerts_1B6520BE.png 574KB Jul 26 2015 07:05:54 AMBanners_and_Alerts_1B6520BE.png
Banners_and_Alerts_1B652044.pngBanners_and_Alerts_1B652044.png 226KB Jul 26 2015 07:03:49 AMBanners_and_Alerts_1B652044.png
Banners_and_Alerts_and_-80_Inventory_Map_-_Google_Sheets_1E959EA7.pngBanners_and_Alerts_and_-80_Inventory_Map... 127KB Apr 05 2017 02:52:27 PMBanners_and_Alerts_and_-80_Inventory_Map_-_Google_Sheets_1E959EA7.png
Banners_and_Alerts_and_2015-03-30_13_21_32_jpg_1ACC53E4.pngBanners_and_Alerts_and_2015-03-30_13_21_... 1873KB Apr 01 2015 09:27:18 AMBanners_and_Alerts_and_2015-03-30_13_21_32_jpg_1ACC53E4.png
Banners_and_Alerts_and_CoGe__My_Data_and_CLC_Genomics_Workbench_8_5_1_and_Add_New_Post_‹_half-shell_—_WordPress_1CAC76A2.pngBanners_and_Alerts_and_CoGe__My_Data_and... 114KB Mar 30 2016 02:03:32 PMBanners_and_Alerts_and_CoGe__My_Data_and_CLC_Genomics_Workbench_8_5_1_and_Add_New_Post_‹_half-shell_—_WordPress_1CAC76A2.png
Banners_and_Alerts_and_Genotoype-by-sequencing_of_three_geographically-distinct_populations_of_the_Olympia_oyster__Ostrea_lurida___Authorea_1E65FD08.pngBanners_and_Alerts_and_Genotoype-by-sequ... 266KB Feb 28 2017 10:46:33 AMBanners_and_Alerts_and_Genotoype-by-sequencing_of_three_geographically-distinct_populations_of_the_Olympia_oyster__Ostrea_lurida___Authorea_1E65FD08.png
Banners_and_Alerts_and_IMG_2919_JPG__9_documents__9_total_pages__1B651E4B.pngBanners_and_Alerts_and_IMG_2919_JPG__9_d... 625KB Jul 26 2015 06:55:25 AMBanners_and_Alerts_and_IMG_2919_JPG__9_documents__9_total_pages__1B651E4B.png
Banners_and_Alerts_and_NCBI_Blast_Nucleotide_Sequence__71_letters__1AF3C8E3.pngBanners_and_Alerts_and_NCBI_Blast_Nucleo... 80KB May 01 2015 07:44:51 AMBanners_and_Alerts_and_NCBI_Blast_Nucleotide_Sequence__71_letters__1AF3C8E3.png
Banners_and_Alerts_and_NCBI_Blast_Nucleotide_Sequence__71_letters__1AF3C831.pngBanners_and_Alerts_and_NCBI_Blast_Nucleo... 132KB May 01 2015 07:41:54 AMBanners_and_Alerts_and_NCBI_Blast_Nucleotide_Sequence__71_letters__1AF3C831.png
Banners_and_Alerts_and_NCBI_Blast_Nucleotide_Sequence__71_letters__1AF3C856.pngBanners_and_Alerts_and_NCBI_Blast_Nucleo... 353KB May 01 2015 07:42:30 AMBanners_and_Alerts_and_NCBI_Blast_Nucleotide_Sequence__71_letters__1AF3C856.png
Banners_and_Alerts_and_Primer-Blast_results_1AF3C96A.pngBanners_and_Alerts_and_Primer-Blast_resu... 181KB May 01 2015 07:47:06 AMBanners_and_Alerts_and_Primer-Blast_results_1AF3C96A.png
Banners_and_Alerts_and_Primer_designing_tool_1AF3C89B.pngBanners_and_Alerts_and_Primer_designing_... 246KB May 01 2015 07:43:39 AMBanners_and_Alerts_and_Primer_designing_tool_1AF3C89B.png
Banners_and_Alerts_and_Roberts_Lab_-_Google__and_New_Tab_1C7E217F.pngBanners_and_Alerts_and_Roberts_Lab_-_Goo... 262KB Feb 24 2016 09:36:02 AMBanners_and_Alerts_and_Roberts_Lab_-_Google__and_New_Tab_1C7E217F.png
Banners_and_Alerts_and_sr320_eimd-sswd_1AFC0B21.pngBanners_and_Alerts_and_sr320_eimd-sswd_1... 118KB May 07 2015 02:05:37 PMBanners_and_Alerts_and_sr320_eimd-sswd_1AFC0B21.png
Bay_scallop_sperming_-_YouTube_19F17E97.pngBay_scallop_sperming_-_YouTube_19F17E97.png 201KB Oct 17 2014 09:43:04 AMBay_scallop_sperming_-_YouTube_19F17E97.png
beacon_title_17B175C1.pngbeacon_title_17B175C1.png 55KB Aug 06 2013 11:26:40 AMbeacon_title_17B175C1.png
beacon_title_17B17658.pngbeacon_title_17B17658.png 55KB Aug 06 2013 11:29:11 AMbeacon_title_17B17658.png
BiGoRNA_GTGTCTAC_1_fastq_FastQC_Report_18E0A92A.pngBiGoRNA_GTGTCTAC_1_fastq_FastQC_Report_1... 34KB Mar 24 2014 10:55:55 AMBiGoRNA_GTGTCTAC_1_fastq_FastQC_Report_18E0A92A.png
BiGo_dev_1A41E5C5.pngBiGo_dev_1A41E5C5.png 49KB Dec 17 2014 08:24:38 AMBiGo_dev_1A41E5C5.png
BiGo_dev_1A41E553.pngBiGo_dev_1A41E553.png 83KB Dec 17 2014 08:22:45 AMBiGo_dev_1A41E553.png
BiGo_dev_1A41EC5B.pngBiGo_dev_1A41EC5B.png 30KB Dec 17 2014 08:52:45 AMBiGo_dev_1A41EC5B.png
BiGo_dev_manu_V2_1A043C91.pngBiGo_dev_manu_V2_1A043C91.png 17KB Oct 31 2014 02:54:27 PMBiGo_dev_manu_V2_1A043C91.png
BiGo_larvae_17FC5D8A.pngBiGo_larvae_17FC5D8A.png 66KB Oct 02 2013 06:56:29 AMBiGo_larvae_17FC5D8A.png
BiGo_larvae_1892C122.pngBiGo_larvae_1892C122.png 54KB Jan 24 2014 07:42:43 AMBiGo_larvae_1892C122.png
BiGo_larvae_1892C389.pngBiGo_larvae_1892C389.png 54KB Jan 24 2014 07:52:58 AMBiGo_larvae_1892C389.png
BiGo_larvae_180350D3.pngBiGo_larvae_180350D3.png 53KB Oct 07 2013 01:28:05 PMBiGo_larvae_180350D3.png
BiGo_larvae_18071336.pngBiGo_larvae_18071336.png 42KB Oct 10 2013 09:54:14 AMBiGo_larvae_18071336.png
BiGo_larvae_methylkit_181ACA2F.pngBiGo_larvae_methylkit_181ACA2F.png 56KB Oct 25 2013 08:48:09 AMBiGo_larvae_methylkit_181ACA2F.png
BiGo_methratio_17A2220E.pngBiGo_methratio_17A2220E.png 50KB Jul 25 2013 08:24:54 PMBiGo_methratio_17A2220E.png
BiGo_methratio_17A2231A.pngBiGo_methratio_17A2231A.png 43KB Jul 25 2013 08:29:22 PMBiGo_methratio_17A2231A.png
BiGo_methratio_17AC0108.pngBiGo_methratio_17AC0108.png 42KB Aug 02 2013 08:07:05 AMBiGo_methratio_17AC0108.png
BiGo_methratio_hist.key_17AC05EE.pngBiGo_methratio_hist.key_17AC05EE.png 138KB Aug 02 2013 08:27:59 AMBiGo_methratio_hist.key_17AC05EE.png
BiGo_methratio_hist.key_17AC059E.pngBiGo_methratio_hist.key_17AC059E.png 144KB Aug 02 2013 08:26:40 AMBiGo_methratio_hist.key_17AC059E.png
Bioinformatics_Data_Skills_pdf__page_7_of_538__1D9C6A89.pngBioinformatics_Data_Skills_pdf__page_7_o... 101KB Sep 28 2016 02:15:55 PMBioinformatics_Data_Skills_pdf__page_7_of_538__1D9C6A89.png
Bioinformatics_Data_Skills__Reproducible_and_Robust_Research_with_Open_Source_Tools__Vince_Buffalo__9781449367374__Amazon_com__Books_1D9C69E4.pngBioinformatics_Data_Skills__Reproducible... 76KB Sep 28 2016 02:13:11 PMBioinformatics_Data_Skills__Reproducible_and_Robust_Research_with_Open_Source_Tools__Vince_Buffalo__9781449367374__Amazon_com__Books_1D9C69E4.png
Bioinformatics_–_Trimmomatic_FASTQC_on_C_gigas_Larvae_OA_NGS_Data___Sam_s_Notebook_1B01001D.pngBioinformatics_–_Trimmomatic_FASTQC_on... 122KB May 11 2015 08:19:58 AMBioinformatics_–_Trimmomatic_FASTQC_on_C_gigas_Larvae_OA_NGS_Data___Sam_s_Notebook_1B01001D.png
BioInfo_Intro_pdf__page_2_of_22__1D9C5137.pngBioInfo_Intro_pdf__page_2_of_22__1D9C513... 615KB Sep 28 2016 12:27:57 PMBioInfo_Intro_pdf__page_2_of_22__1D9C5137.png
BioMart_-_MartView_1AF28BC1.pngBioMart_-_MartView_1AF28BC1.png 138KB Apr 30 2015 09:11:46 AMBioMart_-_MartView_1AF28BC1.png
BioMart_-_MartView_1AF28D1E.pngBioMart_-_MartView_1AF28D1E.png 191KB Apr 30 2015 09:17:34 AMBioMart_-_MartView_1AF28D1E.png
biorxiv_org_content_biorxiv_early_2015_03_13_012831_full_pdf_1B4EF6FD.pngbiorxiv_org_content_biorxiv_early_2015_0... 43KB Jul 09 2015 11:37:40 AMbiorxiv_org_content_biorxiv_early_2015_03_13_012831_full_pdf_1B4EF6FD.png
biorxiv_org_content_biorxiv_early_2015_03_13_012831_full_pdf_1BC01AE5.pngbiorxiv_org_content_biorxiv_early_2015_0... 48KB Oct 03 2015 07:17:10 AMbiorxiv_org_content_biorxiv_early_2015_03_13_012831_full_pdf_1BC01AE5.png
BioSample_Attributes___Submission_Portal_1A3B1ECD.pngBioSample_Attributes___Submission_Portal... 162KB Dec 12 2014 05:02:07 AMBioSample_Attributes___Submission_Portal_1A3B1ECD.png
blast_187C98FA.pngblast_187C98FA.png 92KB Jan 07 2014 12:20:14 PMblast_187C98FA.png
BLAST__Basic_Local_Alignment_Search_Tool_1BD92197.pngBLAST__Basic_Local_Alignment_Search_Tool... 51KB Oct 22 2015 06:52:25 AMBLAST__Basic_Local_Alignment_Search_Tool_1BD92197.png
BLAST__Basic_Local_Alignment_Search_Tool_187C98A6.pngBLAST__Basic_Local_Alignment_Search_Tool... 92KB Jan 07 2014 12:18:51 PMBLAST__Basic_Local_Alignment_Search_Tool_187C98A6.png
BLAST__Basic_Local_Alignment_Search_Tool_19911BE7.pngBLAST__Basic_Local_Alignment_Search_Tool... 35KB Aug 05 2014 07:04:23 AMBLAST__Basic_Local_Alignment_Search_Tool_19911BE7.png
BLAST__Release_Notes_-_BLAST®_Help_-_NCBI_Bookshelf_187C99D4.pngBLAST__Release_Notes_-_BLAST®_Help_-_NC... 48KB Jan 07 2014 12:23:51 PMBLAST__Release_Notes_-_BLAST®_Help_-_NCBI_Bookshelf_187C99D4.png
BMC_Genomics___Full_text___DNA_methylation_patterns_provide_insight_into_epigenetic_regulation_in_the_Pacific_oyster__Crassostrea_gigas__1A0683A5.pngBMC_Genomics___Full_text___DNA_methylati... 26KB Nov 02 2014 07:22:14 AMBMC_Genomics___Full_text___DNA_methylation_patterns_provide_insight_into_epigenetic_regulation_in_the_Pacific_oyster__Crassostrea_gigas__1A0683A5.png
BMC_Genomics___Full_text___ReadqPCR_and_NormqPCR__R_packages_for_the_reading__quality_checking_and_normalisation_of_RT-qPCR_quantification_cycle__Cq__data_1B42FF07.pngBMC_Genomics___Full_text___ReadqPCR_and_... 80KB Jun 30 2015 09:44:56 AMBMC_Genomics___Full_text___ReadqPCR_and_NormqPCR__R_packages_for_the_reading__quality_checking_and_normalisation_of_RT-qPCR_quantification_cycle__Cq__data_1B42FF07.png
BMC_Genomics___Full_text___RNA-Seq_in__it_Mytilus_galloprovincialis__it___comparative_transcriptomics_and_expression_profiles_among_different_tissues_1C11D3DC.pngBMC_Genomics___Full_text___RNA-Seq_in__i... 51KB Dec 04 2015 06:00:01 AMBMC_Genomics___Full_text___RNA-Seq_in__it_Mytilus_galloprovincialis__it___comparative_transcriptomics_and_expression_profiles_among_different_tissues_1C11D3DC.png
BMC_Genomics___Full_text___Shotgun_proteomics_reveals_physiological_response_to_ocean_acidification_in_Crassostrea_gigas_1BBEF5D2.pngBMC_Genomics___Full_text___Shotgun_prote... 145KB Oct 02 2015 10:26:43 AMBMC_Genomics___Full_text___Shotgun_proteomics_reveals_physiological_response_to_ocean_acidification_in_Crassostrea_gigas_1BBEF5D2.png
BMC_Genomics___Full_text___Shotgun_proteomics_reveals_physiological_response_to_ocean_acidification_in_Crassostrea_gigas_1BBEF69E.pngBMC_Genomics___Full_text___Shotgun_prote... 28KB Oct 02 2015 10:30:06 AMBMC_Genomics___Full_text___Shotgun_proteomics_reveals_physiological_response_to_ocean_acidification_in_Crassostrea_gigas_1BBEF69E.png
Book_1AA0DEB2.pngBook_1AA0DEB2.png 40KB Feb 27 2015 09:19:47 AMBook_1AA0DEB2.png
Book_1AA0E824.pngBook_1AA0E824.png 40KB Feb 27 2015 10:00:04 AMBook_1AA0E824.png
bp_17E9F3A5.pngbp_17E9F3A5.png 186KB Sep 18 2013 07:43:50 AMbp_17E9F3A5.png
bp_17EA1C51.pngbp_17EA1C51.png 92KB Sep 18 2013 10:37:22 AMbp_17EA1C51.png
BS-seq_Libraries_for_Sequencing_at_Genewiz___Sam_s_Notebook_1C4FF20D.pngBS-seq_Libraries_for_Sequencing_at_Genew... 55KB Jan 20 2016 08:49:19 AMBS-seq_Libraries_for_Sequencing_at_Genewiz___Sam_s_Notebook_1C4FF20D.png
BS-seq_Libraries_for_Sequencing_at_Genewiz___Sam_s_Notebook_1C505006.pngBS-seq_Libraries_for_Sequencing_at_Genew... 52KB Jan 20 2016 03:30:16 PMBS-seq_Libraries_for_Sequencing_at_Genewiz___Sam_s_Notebook_1C505006.png
BS-seq_Libraries_for_Sequencing_at_Genewiz___Sam_s_Notebook_1C505191.pngBS-seq_Libraries_for_Sequencing_at_Genew... 61KB Jan 20 2016 03:36:50 PMBS-seq_Libraries_for_Sequencing_at_Genewiz___Sam_s_Notebook_1C505191.png
BSMAP-03b-Genomev2-10x_1CB41B7A.pngBSMAP-03b-Genomev2-10x_1CB41B7A.png 125KB Apr 05 2016 09:12:43 AMBSMAP-03b-Genomev2-10x_1CB41B7A.png
BSMAP-03b-Genomev2-10x_1CB41B9E.pngBSMAP-03b-Genomev2-10x_1CB41B9E.png 73KB Apr 05 2016 09:13:19 AMBSMAP-03b-Genomev2-10x_1CB41B9E.png
BSMAP-03b-Genomev2-10x_1CB41B53.pngBSMAP-03b-Genomev2-10x_1CB41B53.png 114KB Apr 05 2016 09:12:05 AMBSMAP-03b-Genomev2-10x_1CB41B53.png
BSMAP-03b-Genomev2-10x_1CB41B65.pngBSMAP-03b-Genomev2-10x_1CB41B65.png 114KB Apr 05 2016 09:12:22 AMBSMAP-03b-Genomev2-10x_1CB41B65.png
BSMAP-03b-Genomev2-10x_1CB41BC9.pngBSMAP-03b-Genomev2-10x_1CB41BC9.png 37KB Apr 05 2016 09:14:02 AMBSMAP-03b-Genomev2-10x_1CB41BC9.png
BSMAP-05-BGIv001_1CB41C8D.pngBSMAP-05-BGIv001_1CB41C8D.png 62KB Apr 05 2016 09:17:18 AMBSMAP-05-BGIv001_1CB41C8D.png
BSMAP-05-BGIv001_1CB41CB3.pngBSMAP-05-BGIv001_1CB41CB3.png 97KB Apr 05 2016 09:17:56 AMBSMAP-05-BGIv001_1CB41CB3.png
BSMAP-06-BGIv002_1CC19CB1.pngBSMAP-06-BGIv002_1CC19CB1.png 99KB Apr 15 2016 03:03:31 PMBSMAP-06-BGIv002_1CC19CB1.png
C360_2013-08-29-18-07-12-281.jpg__907×546__17D0F8D1.pngC360_2013-08-29-18-07-12-281.jpg__907×5... 685KB Aug 30 2013 09:07:24 AMC360_2013-08-29-18-07-12-281.jpg__907×546__17D0F8D1.png
Calculator_and_RStudio_18059556.pngCalculator_and_RStudio_18059556.png 27KB Oct 09 2013 06:44:56 AMCalculator_and_RStudio_18059556.png
Camera_Uploads_1C5BE2A3.pngCamera_Uploads_1C5BE2A3.png 212KB Jan 29 2016 10:10:43 AMCamera_Uploads_1C5BE2A3.png
Camera_Uploads_1E0C80BC.pngCamera_Uploads_1E0C80BC.png 509KB Dec 22 2016 01:44:31 PMCamera_Uploads_1E0C80BC.png
Camera_Uploads_1E0C81F0.pngCamera_Uploads_1E0C81F0.png 591KB Dec 22 2016 01:49:38 PMCamera_Uploads_1E0C81F0.png
Camera_Uploads_1E0C810A.pngCamera_Uploads_1E0C810A.png 668KB Dec 22 2016 01:45:48 PMCamera_Uploads_1E0C810A.png
Camera_Uploads_1E0C812C.pngCamera_Uploads_1E0C812C.png 591KB Dec 22 2016 01:46:23 PMCamera_Uploads_1E0C812C.png
Camera_Uploads_1E0C813E.pngCamera_Uploads_1E0C813E.png 360KB Dec 22 2016 01:46:40 PMCamera_Uploads_1E0C813E.png
Camera_Uploads_1E0C817C.pngCamera_Uploads_1E0C817C.png 353KB Dec 22 2016 01:47:41 PMCamera_Uploads_1E0C817C.png
Camera_Uploads_1E0C8158.pngCamera_Uploads_1E0C8158.png 682KB Dec 22 2016 01:47:06 PMCamera_Uploads_1E0C8158.png
Can-I_md_1DA19063.pngCan-I_md_1DA19063.png 57KB Oct 02 2016 11:58:46 AMCan-I_md_1DA19063.png
Capstone_2014___Roberts_Lab_194CEF8E.pngCapstone_2014___Roberts_Lab_194CEF8E.png 17KB Jun 14 2014 02:01:03 PMCapstone_2014___Roberts_Lab_194CEF8E.png
Catalyst_GoPost_1E9BD9B0.pngCatalyst_GoPost_1E9BD9B0.png 105KB Apr 10 2017 08:18:10 AMCatalyst_GoPost_1E9BD9B0.png
Catalyst_GoPost_19D5A3F9.pngCatalyst_GoPost_19D5A3F9.png 31KB Sep 26 2014 06:39:07 AMCatalyst_GoPost_19D5A3F9.png
Catch___Release_Severe_Complications_-_YouTube_19F17E57.pngCatch___Release_Severe_Complications_-_Y... 85KB Oct 17 2014 09:42:01 AMCatch___Release_Severe_Complications_-_YouTube_19F17E57.png
cd-hit-otu-illumina-0_0_1_—_bash_—_142×56_and_nb-2016_1CAEDD26.pngcd-hit-otu-illumina-0_0_1_—_bash_—_1... 86KB Apr 01 2016 09:45:29 AMcd-hit-otu-illumina-0_0_1_—_bash_—_142×56_and_nb-2016_1CAEDD26.png
CD-HIT-OTU_-_Download_and_git-repos_1CAEDBAE.pngCD-HIT-OTU_-_Download_and_git-repos_1CAE... 81KB Apr 01 2016 09:39:15 AMCD-HIT-OTU_-_Download_and_git-repos_1CAEDBAE.png
cdna_-_Google_Search_1B00E717.pngcdna_-_Google_Search_1B00E717.png 54KB May 11 2015 06:33:11 AMcdna_-_Google_Search_1B00E717.png
Cg_larvae_BSseq_17F22759.pngCg_larvae_BSseq_17F22759.png 117KB Sep 24 2013 01:02:34 PMCg_larvae_BSseq_17F22759.png
che625_olson-ms-nb_1BC01A88.pngche625_olson-ms-nb_1BC01A88.png 114KB Oct 03 2015 07:15:41 AMche625_olson-ms-nb_1BC01A88.png
chinook_salmon___Flickr_-_Photo_Sharing__17F496E9.pngchinook_salmon___Flickr_-_Photo_Sharing_... 606KB Sep 26 2013 09:23:07 AMchinook_salmon___Flickr_-_Photo_Sharing__17F496E9.png
CICESE__blast-sqlshare-excel_-_YouTube_🔊_1DC242CC.pngCICESE__blast-sqlshare-excel_-_YouTube_... 193KB Oct 27 2016 07:12:29 AMCICESE__blast-sqlshare-excel_-_YouTube_🔊_1DC242CC.png
CICESE__Steven_does_SQLShare_-_YouTube_🔊_1DC2438E.pngCICESE__Steven_does_SQLShare_-_YouTube_... 210KB Oct 27 2016 07:15:43 AMCICESE__Steven_does_SQLShare_-_YouTube_🔊_1DC2438E.png
Claire_Olson_-_Google__19E824D9.pngClaire_Olson_-_Google__19E824D9.png 266KB Oct 10 2014 07:29:46 AMClaire_Olson_-_Google__19E824D9.png
CLC_Genomics_Workbench_4.0.3__Current_workspace__Default__18917D70.pngCLC_Genomics_Workbench_4.0.3__Current_wo... 101KB Jan 23 2014 08:41:35 AMCLC_Genomics_Workbench_4.0.3__Current_workspace__Default__18917D70.png
CLC_Genomics_Workbench_6.0.2_17A1B4E8.pngCLC_Genomics_Workbench_6.0.2_17A1B4E8.png 36KB Jul 25 2013 12:39:14 PMCLC_Genomics_Workbench_6.0.2_17A1B4E8.png
CLC_Genomics_Workbench_6.0.2_17A1B50E.pngCLC_Genomics_Workbench_6.0.2_17A1B50E.png 39KB Jul 25 2013 12:39:53 PMCLC_Genomics_Workbench_6.0.2_17A1B50E.png
CLC_Genomics_Workbench_6.0.2_17AB0078.pngCLC_Genomics_Workbench_6.0.2_17AB0078.png 65KB Aug 01 2013 01:52:25 PMCLC_Genomics_Workbench_6.0.2_17AB0078.png
CLC_Genomics_Workbench_6.0.2_179E116C.pngCLC_Genomics_Workbench_6.0.2_179E116C.png 4KB Jul 22 2013 06:24:46 PMCLC_Genomics_Workbench_6.0.2_179E116C.png
CLC_Genomics_Workbench_6.0.2_179F262E.pngCLC_Genomics_Workbench_6.0.2_179F262E.png 56KB Jul 23 2013 02:05:36 PMCLC_Genomics_Workbench_6.0.2_179F262E.png
CLC_Genomics_Workbench_6.5_17C807FD.pngCLC_Genomics_Workbench_6.5_17C807FD.png 46KB Aug 23 2013 02:21:22 PMCLC_Genomics_Workbench_6.5_17C807FD.png
CLC_Genomics_Workbench_6.5_17C8080E.pngCLC_Genomics_Workbench_6.5_17C8080E.png 44KB Aug 23 2013 02:21:38 PMCLC_Genomics_Workbench_6.5_17C8080E.png
CLC_Genomics_Workbench_6.5_17C80837.pngCLC_Genomics_Workbench_6.5_17C80837.png 44KB Aug 23 2013 02:22:20 PMCLC_Genomics_Workbench_6.5_17C80837.png
CLC_Genomics_Workbench_6.5_17C80873.pngCLC_Genomics_Workbench_6.5_17C80873.png 47KB Aug 23 2013 02:23:20 PMCLC_Genomics_Workbench_6.5_17C80873.png
CLC_Genomics_Workbench_6.5_17CFABB2.pngCLC_Genomics_Workbench_6.5_17CFABB2.png 18KB Aug 29 2013 09:26:01 AMCLC_Genomics_Workbench_6.5_17CFABB2.png
CLC_Genomics_Workbench_6.5_17E0D7AD.pngCLC_Genomics_Workbench_6.5_17E0D7AD.png 28KB Sep 11 2013 09:54:10 AMCLC_Genomics_Workbench_6.5_17E0D7AD.png
CLC_Genomics_Workbench_6.5_17E0D854.pngCLC_Genomics_Workbench_6.5_17E0D854.png 42KB Sep 11 2013 09:56:55 AMCLC_Genomics_Workbench_6.5_17E0D854.png
CLC_Genomics_Workbench_6.5_17E0E134.pngCLC_Genomics_Workbench_6.5_17E0E134.png 59KB Sep 11 2013 10:34:50 AMCLC_Genomics_Workbench_6.5_17E0E134.png
CLC_Genomics_Workbench_6.5_17E8EF4F.pngCLC_Genomics_Workbench_6.5_17E8EF4F.png 43KB Sep 17 2013 01:13:10 PMCLC_Genomics_Workbench_6.5_17E8EF4F.png
CLC_Genomics_Workbench_6.5_17E8EF30.pngCLC_Genomics_Workbench_6.5_17E8EF30.png 31KB Sep 17 2013 01:12:32 PMCLC_Genomics_Workbench_6.5_17E8EF30.png
CLC_Genomics_Workbench_6.5_17E8EF74.pngCLC_Genomics_Workbench_6.5_17E8EF74.png 31KB Sep 17 2013 01:13:41 PMCLC_Genomics_Workbench_6.5_17E8EF74.png
CLC_Genomics_Workbench_6.5_17E8EFFC.pngCLC_Genomics_Workbench_6.5_17E8EFFC.png 41KB Sep 17 2013 01:15:57 PMCLC_Genomics_Workbench_6.5_17E8EFFC.png
CLC_Genomics_Workbench_6.5_17E8F00A.pngCLC_Genomics_Workbench_6.5_17E8F00A.png 41KB Sep 17 2013 01:16:11 PMCLC_Genomics_Workbench_6.5_17E8F00A.png
CLC_Genomics_Workbench_6.5_17E8F10C.pngCLC_Genomics_Workbench_6.5_17E8F10C.png 34KB Sep 17 2013 01:20:30 PMCLC_Genomics_Workbench_6.5_17E8F10C.png
CLC_Genomics_Workbench_6.5_17E8F136.pngCLC_Genomics_Workbench_6.5_17E8F136.png 36KB Sep 17 2013 01:21:12 PMCLC_Genomics_Workbench_6.5_17E8F136.png
CLC_Genomics_Workbench_6.5_17E2669D.pngCLC_Genomics_Workbench_6.5_17E2669D.png 65KB Sep 12 2013 02:16:17 PMCLC_Genomics_Workbench_6.5_17E2669D.png
CLC_Genomics_Workbench_6.5_17F63AF4.pngCLC_Genomics_Workbench_6.5_17F63AF4.png 52KB Sep 27 2013 03:15:20 PMCLC_Genomics_Workbench_6.5_17F63AF4.png
CLC_Genomics_Workbench_6.5_17FB3EF4.pngCLC_Genomics_Workbench_6.5_17FB3EF4.png 88KB Oct 01 2013 10:33:42 AMCLC_Genomics_Workbench_6.5_17FB3EF4.png
CLC_Genomics_Workbench_6.5_181ECE64.pngCLC_Genomics_Workbench_6.5_181ECE64.png 63KB Oct 28 2013 09:55:01 AMCLC_Genomics_Workbench_6.5_181ECE64.png
CLC_Genomics_Workbench_6.5_1819BB68.pngCLC_Genomics_Workbench_6.5_1819BB68.png 21KB Oct 24 2013 01:32:43 PMCLC_Genomics_Workbench_6.5_1819BB68.png
CLC_Genomics_Workbench_6.5_1819BBF6.pngCLC_Genomics_Workbench_6.5_1819BBF6.png 19KB Oct 24 2013 01:35:09 PMCLC_Genomics_Workbench_6.5_1819BBF6.png
CLC_Genomics_Workbench_6.5_180602CC.pngCLC_Genomics_Workbench_6.5_180602CC.png 63KB Oct 09 2013 02:31:57 PMCLC_Genomics_Workbench_6.5_180602CC.png
CLC_Genomics_Workbench_6.5_1806021D.pngCLC_Genomics_Workbench_6.5_1806021D.png 64KB Oct 09 2013 02:29:02 PMCLC_Genomics_Workbench_6.5_1806021D.png
CLC_Genomics_Workbench_6.5_1806036F.pngCLC_Genomics_Workbench_6.5_1806036F.png 55KB Oct 09 2013 02:34:40 PMCLC_Genomics_Workbench_6.5_1806036F.png
CLC_Genomics_Workbench_6.5_18060129.pngCLC_Genomics_Workbench_6.5_18060129.png 33KB Oct 09 2013 02:24:58 PMCLC_Genomics_Workbench_6.5_18060129.png
CLC_Genomics_Workbench_6.5_18060151.pngCLC_Genomics_Workbench_6.5_18060151.png 120KB Oct 09 2013 02:25:39 PMCLC_Genomics_Workbench_6.5_18060151.png
CLC_Genomics_Workbench_6.5_18060212.pngCLC_Genomics_Workbench_6.5_18060212.png 64KB Oct 09 2013 02:28:52 PMCLC_Genomics_Workbench_6.5_18060212.png
CLC_Genomics_Workbench_6.5_18197688.pngCLC_Genomics_Workbench_6.5_18197688.png 48KB Oct 24 2013 08:38:53 AMCLC_Genomics_Workbench_6.5_18197688.png
CLC_Genomics_Workbench_6.5_and_546306A03_121101-OysterV9-MG-meth-HX3_2013-08-07T102757_peaks.gff_17C8085B.pngCLC_Genomics_Workbench_6.5_and_546306A03... 93KB Aug 23 2013 02:22:56 PMCLC_Genomics_Workbench_6.5_and_546306A03_121101-OysterV9-MG-meth-HX3_2013-08-07T102757_peaks.gff_17C8085B.png
CLC_Genomics_Workbench_6.5_Beta_3_17A6B13D.pngCLC_Genomics_Workbench_6.5_Beta_3_17A6B1... 45KB Jul 29 2013 07:25:07 AMCLC_Genomics_Workbench_6.5_Beta_3_17A6B13D.png
CLC_Genomics_Workbench_7_0_4_1A03E642.pngCLC_Genomics_Workbench_7_0_4_1A03E642.png 30KB Oct 31 2014 08:46:12 AMCLC_Genomics_Workbench_7_0_4_1A03E642.png
CLC_Genomics_Workbench_7_0_4_195B0AB2.pngCLC_Genomics_Workbench_7_0_4_195B0AB2.png 14KB Jun 25 2014 06:48:35 AMCLC_Genomics_Workbench_7_0_4_195B0AB2.png
CLC_Genomics_Workbench_7_0_4_195B0AD6.pngCLC_Genomics_Workbench_7_0_4_195B0AD6.png 34KB Jun 25 2014 06:49:11 AMCLC_Genomics_Workbench_7_0_4_195B0AD6.png
CLC_Genomics_Workbench_7_0_4_195B15F3.pngCLC_Genomics_Workbench_7_0_4_195B15F3.png 71KB Jun 25 2014 07:36:37 AMCLC_Genomics_Workbench_7_0_4_195B15F3.png
CLC_Genomics_Workbench_7_0_4_195B166E.pngCLC_Genomics_Workbench_7_0_4_195B166E.png 24KB Jun 25 2014 07:38:39 AMCLC_Genomics_Workbench_7_0_4_195B166E.png
CLC_Genomics_Workbench_7_0_4_195B168F.pngCLC_Genomics_Workbench_7_0_4_195B168F.png 7KB Jun 25 2014 07:39:12 AMCLC_Genomics_Workbench_7_0_4_195B168F.png
CLC_Genomics_Workbench_7_0_18E1E1D9.pngCLC_Genomics_Workbench_7_0_18E1E1D9.png 49KB Mar 25 2014 09:10:03 AMCLC_Genomics_Workbench_7_0_18E1E1D9.png
CLC_Genomics_Workbench_7_5_1_1A44A53F.pngCLC_Genomics_Workbench_7_5_1_1A44A53F.png 39KB Dec 19 2014 10:26:09 AMCLC_Genomics_Workbench_7_5_1_1A44A53F.png
CLC_Genomics_Workbench_7_5_1_1A44A571.pngCLC_Genomics_Workbench_7_5_1_1A44A571.png 29KB Dec 19 2014 10:26:58 AMCLC_Genomics_Workbench_7_5_1_1A44A571.png
CLC_Genomics_Workbench_7_5_1_1A6453BC.pngCLC_Genomics_Workbench_7_5_1_1A6453BC.png 101KB Jan 12 2015 11:10:53 AMCLC_Genomics_Workbench_7_5_1_1A6453BC.png
CLC_Genomics_Workbench_7_5_1_1A6453E8.pngCLC_Genomics_Workbench_7_5_1_1A6453E8.png 30KB Jan 12 2015 11:11:37 AMCLC_Genomics_Workbench_7_5_1_1A6453E8.png
CLC_Genomics_Workbench_7_5_1_1A64540F.pngCLC_Genomics_Workbench_7_5_1_1A64540F.png 39KB Jan 12 2015 11:12:16 AMCLC_Genomics_Workbench_7_5_1_1A64540F.png
CLC_Genomics_Workbench_7_5_1_1A64548B.pngCLC_Genomics_Workbench_7_5_1_1A64548B.png 156KB Jan 12 2015 11:14:20 AMCLC_Genomics_Workbench_7_5_1_1A64548B.png
CLC_Genomics_Workbench_7_5_1_1A645463.pngCLC_Genomics_Workbench_7_5_1_1A645463.png 37KB Jan 12 2015 11:13:40 AMCLC_Genomics_Workbench_7_5_1_1A645463.png
CLC_Genomics_Workbench_7_5_1_1A645485.pngCLC_Genomics_Workbench_7_5_1_1A645485.png 156KB Jan 12 2015 11:14:15 AMCLC_Genomics_Workbench_7_5_1_1A645485.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B2B4C2A.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 49KB Jun 12 2015 10:19:38 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B2B4C2A.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39C3CA.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 28KB Jun 23 2015 09:41:46 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39C3CA.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39C15A.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 29KB Jun 23 2015 09:31:22 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39C15A.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39C23F.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 51KB Jun 23 2015 09:35:12 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39C23F.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39C99F.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 44KB Jun 23 2015 10:06:40 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39C99F.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39C826.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 43KB Jun 23 2015 10:00:23 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39C826.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39CB03.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 21KB Jun 23 2015 10:12:36 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39CB03.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39CC30.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 43KB Jun 23 2015 10:17:37 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39CC30.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39CD9F.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 32KB Jun 23 2015 10:23:43 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39CD9F.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39CD60.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 28KB Jun 23 2015 10:22:40 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39CD60.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39CDCF.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 56KB Jun 23 2015 10:24:31 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39CDCF.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39CEEF.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 52KB Jun 23 2015 10:29:20 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39CEEF.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39D08C.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 60KB Jun 23 2015 10:36:13 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39D08C.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39D125.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 45KB Jun 23 2015 10:38:46 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B39D125.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B33305F.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 45KB Jun 18 2015 09:59:10 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B33305F.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B333010.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 85KB Jun 18 2015 09:57:51 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B333010.png
CLC_Genomics_Workbench_8_0_1_-_Evaluation_1B333038.pngCLC_Genomics_Workbench_8_0_1_-_Evaluatio... 55KB Jun 18 2015 09:58:30 AMCLC_Genomics_Workbench_8_0_1_-_Evaluation_1B333038.png
CLC_Genomics_Workbench_8_0_2_1B4C3F23.pngCLC_Genomics_Workbench_8_0_2_1B4C3F23.png 16KB Jul 07 2015 10:08:47 AMCLC_Genomics_Workbench_8_0_2_1B4C3F23.png
CLC_Genomics_Workbench_8_0_2_1B4C32BD.pngCLC_Genomics_Workbench_8_0_2_1B4C32BD.png 62KB Jul 07 2015 09:15:51 AMCLC_Genomics_Workbench_8_0_2_1B4C32BD.png
CLC_Genomics_Workbench_8_0_2_1B4C327A.pngCLC_Genomics_Workbench_8_0_2_1B4C327A.png 86KB Jul 07 2015 09:14:46 AMCLC_Genomics_Workbench_8_0_2_1B4C327A.png
CLC_Genomics_Workbench_8_0_2_1B4C328E.pngCLC_Genomics_Workbench_8_0_2_1B4C328E.png 86KB Jul 07 2015 09:15:04 AMCLC_Genomics_Workbench_8_0_2_1B4C328E.png
CLC_Genomics_Workbench_8_5_1_1CAD8B6E.pngCLC_Genomics_Workbench_8_5_1_1CAD8B6E.png 85KB Mar 31 2016 09:44:34 AMCLC_Genomics_Workbench_8_5_1_1CAD8B6E.png
CLC_Genomics_Workbench_8_5_1_1CAD8BCB.pngCLC_Genomics_Workbench_8_5_1_1CAD8BCB.png 84KB Mar 31 2016 09:46:05 AMCLC_Genomics_Workbench_8_5_1_1CAD8BCB.png
CLC_Genomics_Workbench_8_5_1_1CAD8C1D.pngCLC_Genomics_Workbench_8_5_1_1CAD8C1D.png 14KB Mar 31 2016 09:47:26 AMCLC_Genomics_Workbench_8_5_1_1CAD8C1D.png
CLC_Genomics_Workbench_8_5_1_1CAD8C40.pngCLC_Genomics_Workbench_8_5_1_1CAD8C40.png 82KB Mar 31 2016 09:48:01 AMCLC_Genomics_Workbench_8_5_1_1CAD8C40.png
CLC_Genomics_Workbench_8_5_1_1DE64194.pngCLC_Genomics_Workbench_8_5_1_1DE64194.png 69KB Nov 23 2016 01:28:54 PMCLC_Genomics_Workbench_8_5_1_1DE64194.png
CLC_Genomics_Workbench_8_5_1_1E0D7BFB.pngCLC_Genomics_Workbench_8_5_1_1E0D7BFB.png 100KB Dec 23 2016 07:36:29 AMCLC_Genomics_Workbench_8_5_1_1E0D7BFB.png
CLC_Genomics_Workbench_8_5_1_1E0D7F80.pngCLC_Genomics_Workbench_8_5_1_1E0D7F80.png 125KB Dec 23 2016 07:51:29 AMCLC_Genomics_Workbench_8_5_1_1E0D7F80.png
CLC_Sequence_Viewer_6_6_1_19806EFF.pngCLC_Sequence_Viewer_6_6_1_19806EFF.png 144KB Jul 23 2014 03:30:24 PMCLC_Sequence_Viewer_6_6_1_19806EFF.png
CoGe_on_Fidalgo_Sibs_–_quarter-shell_–_Staging_for_my_Lab_Notebook_1D918681.pngCoGe_on_Fidalgo_Sibs_–_quarter-shell_... 62KB Sep 20 2016 08:00:20 AMCoGe_on_Fidalgo_Sibs_–_quarter-shell_–_Staging_for_my_Lab_Notebook_1D918681.png
CoGe__BLAST_1E86E946.pngCoGe__BLAST_1E86E946.png 157KB Mar 25 2017 11:07:05 AMCoGe__BLAST_1E86E946.png
CoGe__ExperimentView_1DAACD70.pngCoGe__ExperimentView_1DAACD70.png 140KB Oct 09 2016 12:09:34 PMCoGe__ExperimentView_1DAACD70.png
CoGe__ExperimentView_1DAACDAF.pngCoGe__ExperimentView_1DAACDAF.png 90KB Oct 09 2016 12:10:37 PMCoGe__ExperimentView_1DAACDAF.png
CoGe__ExperimentView_1DAAD14F.pngCoGe__ExperimentView_1DAAD14F.png 113KB Oct 09 2016 12:26:06 PMCoGe__ExperimentView_1DAAD14F.png
CoGe__ExperimentView_1E7B2720.pngCoGe__ExperimentView_1E7B2720.png 101KB Mar 16 2017 01:03:45 PMCoGe__ExperimentView_1E7B2720.png
CoGe__GenomeInfo_1DCFBDA7.pngCoGe__GenomeInfo_1DCFBDA7.png 117KB Nov 06 2016 11:36:09 AMCoGe__GenomeInfo_1DCFBDA7.png
CoGe__GenomeInfo_1DCFBDF9.pngCoGe__GenomeInfo_1DCFBDF9.png 127KB Nov 06 2016 11:37:33 AMCoGe__GenomeInfo_1DCFBDF9.png
CoGe__GenomeInfo_and_untitled_text_3_1E3D4EF7.pngCoGe__GenomeInfo_and_untitled_text_3_1E3... 128KB Jan 28 2017 02:13:14 PMCoGe__GenomeInfo_and_untitled_text_3_1E3D4EF7.png
CoGe__GEvo_1E86F395.pngCoGe__GEvo_1E86F395.png 112KB Mar 25 2017 11:51:03 AMCoGe__GEvo_1E86F395.png
CoGe__LoadExperiment_1DAACCFA.pngCoGe__LoadExperiment_1DAACCFA.png 131KB Oct 09 2016 12:07:40 PMCoGe__LoadExperiment_1DAACCFA.png
CoGe__LoadExperiment_18CA27FA.pngCoGe__LoadExperiment_18CA27FA.png 40KB Mar 07 2014 08:14:52 AMCoGe__LoadExperiment_18CA27FA.png
CoGe__My_Data_1CAC7724.pngCoGe__My_Data_1CAC7724.png 54KB Mar 30 2016 02:05:41 PMCoGe__My_Data_1CAC7724.png
CoGe__My_Data_1CAD8C90.pngCoGe__My_Data_1CAD8C90.png 78KB Mar 31 2016 09:49:22 AMCoGe__My_Data_1CAD8C90.png
CoGe__My_Data_1CAD8CC2.pngCoGe__My_Data_1CAD8CC2.png 74KB Mar 31 2016 09:50:12 AMCoGe__My_Data_1CAD8CC2.png
CoGe__My_Data_1CAD8CEB.pngCoGe__My_Data_1CAD8CEB.png 123KB Mar 31 2016 09:50:53 AMCoGe__My_Data_1CAD8CEB.png
CoGe__My_Data_1CAD8D42.pngCoGe__My_Data_1CAD8D42.png 117KB Mar 31 2016 09:52:19 AMCoGe__My_Data_1CAD8D42.png
CoGe__My_Data_1CAD8E81.pngCoGe__My_Data_1CAD8E81.png 94KB Mar 31 2016 09:57:38 AMCoGe__My_Data_1CAD8E81.png
CoGe__My_Data_1CAD8F10.pngCoGe__My_Data_1CAD8F10.png 155KB Mar 31 2016 10:00:01 AMCoGe__My_Data_1CAD8F10.png
CoGe__My_Data_1CB982D9.pngCoGe__My_Data_1CB982D9.png 46KB Apr 09 2016 11:35:08 AMCoGe__My_Data_1CB982D9.png
CoGe__My_Data_1CB983D1.pngCoGe__My_Data_1CB983D1.png 45KB Apr 09 2016 11:39:15 AMCoGe__My_Data_1CB983D1.png
CoGe__My_Data_1CB983F4.pngCoGe__My_Data_1CB983F4.png 84KB Apr 09 2016 11:39:50 AMCoGe__My_Data_1CB983F4.png
CoGe__My_Data_1CB98449.pngCoGe__My_Data_1CB98449.png 53KB Apr 09 2016 11:41:15 AMCoGe__My_Data_1CB98449.png
CoGe__My_Data_1CEA6A27.pngCoGe__My_Data_1CEA6A27.png 110KB May 16 2016 01:50:50 PMCoGe__My_Data_1CEA6A27.png
CoGe__My_Data_1CEA66F8.pngCoGe__My_Data_1CEA66F8.png 52KB May 16 2016 01:37:14 PMCoGe__My_Data_1CEA66F8.png
CoGe__My_Data_1CEA6505.pngCoGe__My_Data_1CEA6505.png 96KB May 16 2016 01:28:55 PMCoGe__My_Data_1CEA6505.png
CoGe__My_Data_1CEA6557.pngCoGe__My_Data_1CEA6557.png 45KB May 16 2016 01:30:16 PMCoGe__My_Data_1CEA6557.png
CoGe__My_Data_1CEA6688.pngCoGe__My_Data_1CEA6688.png 83KB May 16 2016 01:35:22 PMCoGe__My_Data_1CEA6688.png
CoGe__My_Data_1DA4556B.pngCoGe__My_Data_1DA4556B.png 73KB Oct 04 2016 02:23:58 PMCoGe__My_Data_1DA4556B.png
CoGe__My_Data_1DA45598.pngCoGe__My_Data_1DA45598.png 101KB Oct 04 2016 02:24:42 PMCoGe__My_Data_1DA45598.png
CoGe__My_Data_1DAAD2E6.pngCoGe__My_Data_1DAAD2E6.png 103KB Oct 09 2016 12:32:51 PMCoGe__My_Data_1DAAD2E6.png
CoGe__My_Data_1DAAD20C.pngCoGe__My_Data_1DAAD20C.png 40KB Oct 09 2016 12:29:13 PMCoGe__My_Data_1DAAD20C.png
CoGe__My_Data_1DCFBEE2.pngCoGe__My_Data_1DCFBEE2.png 49KB Nov 06 2016 11:41:24 AMCoGe__My_Data_1DCFBEE2.png
CoGe__My_Data_1DCFBEFF.pngCoGe__My_Data_1DCFBEFF.png 49KB Nov 06 2016 11:41:52 AMCoGe__My_Data_1DCFBEFF.png
CoGe__My_Data_1DCFC17D.pngCoGe__My_Data_1DCFC17D.png 124KB Nov 06 2016 11:52:30 AMCoGe__My_Data_1DCFC17D.png
CoGe__My_Data_1E3D4FB3.pngCoGe__My_Data_1E3D4FB3.png 30KB Jan 28 2017 02:16:22 PMCoGe__My_Data_1E3D4FB3.png
CoGe__My_Data_1E3D5818.pngCoGe__My_Data_1E3D5818.png 166KB Jan 28 2017 02:52:10 PMCoGe__My_Data_1E3D5818.png
CoGe__My_Data_1E7B29BC.pngCoGe__My_Data_1E7B29BC.png 75KB Mar 16 2017 01:14:53 PMCoGe__My_Data_1E7B29BC.png
CoGe__My_Data_1E86F798.pngCoGe__My_Data_1E86F798.png 157KB Mar 25 2017 12:08:10 PMCoGe__My_Data_1E86F798.png
CoGe__My_Data_1E873736.pngCoGe__My_Data_1E873736.png 167KB Mar 25 2017 04:39:36 PMCoGe__My_Data_1E873736.png
CoGe__My_Data_1E873802.pngCoGe__My_Data_1E873802.png 72KB Mar 25 2017 04:43:00 PMCoGe__My_Data_1E873802.png
CoGe__NotebookView_1E3EB181.pngCoGe__NotebookView_1E3EB181.png 167KB Jan 29 2017 03:25:55 PMCoGe__NotebookView_1E3EB181.png
CoGe__Search_Results_1DCFBD65.pngCoGe__Search_Results_1DCFBD65.png 38KB Nov 06 2016 11:35:05 AMCoGe__Search_Results_1DCFBD65.png
CoGe__SynMap_1E7B255A.pngCoGe__SynMap_1E7B255A.png 184KB Mar 16 2017 12:56:11 PMCoGe__SynMap_1E7B255A.png
CoGe__SynMap_1E7B259C.pngCoGe__SynMap_1E7B259C.png 73KB Mar 16 2017 12:57:17 PMCoGe__SynMap_1E7B259C.png
CoGe__SynMap_1E86F69D.pngCoGe__SynMap_1E86F69D.png 115KB Mar 25 2017 12:03:59 PMCoGe__SynMap_1E86F69D.png
CoGe__SynMap_1E86F319.pngCoGe__SynMap_1E86F319.png 169KB Mar 25 2017 11:49:00 AMCoGe__SynMap_1E86F319.png
CoGe__SynMap_and_06-LoadGenome-SynMap_1E86F6DC.pngCoGe__SynMap_and_06-LoadGenome-SynMap_1E... 75KB Mar 25 2017 12:05:02 PMCoGe__SynMap_and_06-LoadGenome-SynMap_1E86F6DC.png
Coho_Salmon_and_Copper_-_YouTube_19F17FB5.pngCoho_Salmon_and_Copper_-_YouTube_19F17FB... 178KB Oct 17 2014 09:47:50 AMCoho_Salmon_and_Copper_-_YouTube_19F17FB5.png
Colleen_Burge_and_nsf.gov_-_National_Science_Foundation_-_US_National_Science_Foundation__NSF__17A1CDFF.pngColleen_Burge_and_nsf.gov_-_National_Sci... 711KB Jul 25 2013 02:26:17 PMColleen_Burge_and_nsf.gov_-_National_Science_Foundation_-_US_National_Science_Foundation__NSF__17A1CDFF.png
COMBINED_FILES_fq_FastQC_Report_1C503E6F.pngCOMBINED_FILES_fq_FastQC_Report_1C503E6F... 155KB Jan 20 2016 02:15:12 PMCOMBINED_FILES_fq_FastQC_Report_1C503E6F.png
COMBINED_FILES_fq_FastQC_Report_1C503EA6.pngCOMBINED_FILES_fq_FastQC_Report_1C503EA6... 25KB Jan 20 2016 02:16:07 PMCOMBINED_FILES_fq_FastQC_Report_1C503EA6.png
COMBINED_FILES_fq_FastQC_Report_and_2bRAD-data-check_1C503E56.pngCOMBINED_FILES_fq_FastQC_Report_and_2bRA... 130KB Jan 20 2016 02:14:47 PMCOMBINED_FILES_fq_FastQC_Report_and_2bRAD-data-check_1C503E56.png
comparative_jpg__872×123__1A49D393.pngcomparative_jpg__872×123__1A49D393.png 90KB Dec 23 2014 08:45:08 AMcomparative_jpg__872×123__1A49D393.png
Contents_of_folder_112381_-_UW-HTGC_1B387DF8.pngContents_of_folder_112381_-_UW-HTGC_1B38... 205KB Jun 22 2015 10:31:37 AMContents_of_folder_112381_-_UW-HTGC_1B387DF8.png
Contents_of_folder_112381_-_UW-HTGC_1B387E9F.pngContents_of_folder_112381_-_UW-HTGC_1B38... 73KB Jun 22 2015 10:34:23 AMContents_of_folder_112381_-_UW-HTGC_1B387E9F.png
Contents_of_folder_112381_-_UW-HTGC_1B387EE0.pngContents_of_folder_112381_-_UW-HTGC_1B38... 71KB Jun 22 2015 10:35:29 AMContents_of_folder_112381_-_UW-HTGC_1B387EE0.png
contigs_1C1B65BE.pngcontigs_1C1B65BE.png 114KB Dec 11 2015 12:12:53 PMcontigs_1C1B65BE.png
Coquimbo_-_Google_Maps_1A5872D9.pngCoquimbo_-_Google_Maps_1A5872D9.png 287KB Jan 03 2015 10:56:27 AMCoquimbo_-_Google_Maps_1A5872D9.png
Coquimbo_-_Google_Maps_1A58733E.pngCoquimbo_-_Google_Maps_1A58733E.png 294KB Jan 03 2015 10:58:08 AMCoquimbo_-_Google_Maps_1A58733E.png
Coral-CpG-ratio-MS_results_md_at_master_·_jldimond_Coral-CpG-ratio-MS_1B3B95BC.pngCoral-CpG-ratio-MS_results_md_at_master_... 121KB Jun 24 2015 06:49:51 PMCoral-CpG-ratio-MS_results_md_at_master_·_jldimond_Coral-CpG-ratio-MS_1B3B95BC.png
Coral-CpG-ratio-MS_results_md_at_master_·_jldimond_Coral-CpG-ratio-MS_1B3B9612.pngCoral-CpG-ratio-MS_results_md_at_master_... 121KB Jun 24 2015 06:51:15 PMCoral-CpG-ratio-MS_results_md_at_master_·_jldimond_Coral-CpG-ratio-MS_1B3B9612.png
COUPLER2-C___Onset_Data_Loggers_1E09A4DB.pngCOUPLER2-C___Onset_Data_Loggers_1E09A4DB... 137KB Dec 20 2016 09:41:49 AMCOUPLER2-C___Onset_Data_Loggers_1E09A4DB.png
course-btea_analyses_at_master_·_sr320_course-btea_1BDA9B2E.pngcourse-btea_analyses_at_master_·_sr320_... 50KB Oct 23 2015 09:43:30 AMcourse-btea_analyses_at_master_·_sr320_course-btea_1BDA9B2E.png
course-fish310-2015_cnidarian-decadal-memory_pdf_at_master_·_sr320_course-fish310-2015_1AD45D14.pngcourse-fish310-2015_cnidarian-decadal-me... 22KB Apr 07 2015 11:44:37 AMcourse-fish310-2015_cnidarian-decadal-memory_pdf_at_master_·_sr320_course-fish310-2015_1AD45D14.png
course-fish310-2015_QP-lab-A-worksheet_md_at_master_·_sr320_course-fish310-2015_1AFD6852.pngcourse-fish310-2015_QP-lab-A-worksheet_m... 153KB May 08 2015 02:55:31 PMcourse-fish310-2015_QP-lab-A-worksheet_md_at_master_·_sr320_course-fish310-2015_1AFD6852.png
course-fish546-2016_001-fasta2pie_ipynb_at_master_·_sr320_course-fish546-2016_1D91AE7E.pngcourse-fish546-2016_001-fasta2pie_ipynb_... 107KB Sep 20 2016 10:50:58 AMcourse-fish546-2016_001-fasta2pie_ipynb_at_master_·_sr320_course-fish546-2016_1D91AE7E.png
course-fish546_1DA47FD6.pngcourse-fish546_1DA47FD6.png 15KB Oct 04 2016 05:24:59 PMcourse-fish546_1DA47FD6.png
cpgR_comb_1A0585AE.pngcpgR_comb_1A0585AE.png 64KB Nov 01 2014 02:18:40 PMcpgR_comb_1A0585AE.png
crassostrea_forkhead_-_Nucleotide_-_NCBI_1BD90C2B.pngcrassostrea_forkhead_-_Nucleotide_-_NCBI... 203KB Oct 22 2015 05:21:01 AMcrassostrea_forkhead_-_Nucleotide_-_NCBI_1BD90C2B.png
Crassostrea_gigas_forkhead_box_protein_L2-like__LOC105319597___mRNA_-_Nucleotide_-_NCBI_1BD90C9E.pngCrassostrea_gigas_forkhead_box_protein_L... 192KB Oct 22 2015 05:22:56 AMCrassostrea_gigas_forkhead_box_protein_L2-like__LOC105319597___mRNA_-_Nucleotide_-_NCBI_1BD90C9E.png
Crassostrea_gigas_high-throughput_bisulfite_sequencing__gill_tissue__1BBEEDBA.pngCrassostrea_gigas_high-throughput_bisulf... 264KB Oct 02 2015 09:52:10 AMCrassostrea_gigas_high-throughput_bisulfite_sequencing__gill_tissue__1BBEEDBA.png
Crassostrea_gigas_high-throughput_bisulfite_sequencing__gill_tissue__1BBEEDD3.pngCrassostrea_gigas_high-throughput_bisulf... 264KB Oct 02 2015 09:52:36 AMCrassostrea_gigas_high-throughput_bisulfite_sequencing__gill_tissue__1BBEEDD3.png
Crassostrea_gigas_male_gonad_transcriptome_data_comparison_1BBEF4ED.pngCrassostrea_gigas_male_gonad_transcripto... 283KB Oct 02 2015 10:22:54 AMCrassostrea_gigas_male_gonad_transcriptome_data_comparison_1BBEF4ED.png
Crassostrea_gigas_male_gonad_transcriptome_data_comparison_1BE3AD5C.pngCrassostrea_gigas_male_gonad_transcripto... 138KB Oct 30 2015 06:51:31 AMCrassostrea_gigas_male_gonad_transcriptome_data_comparison_1BE3AD5C.png
Crassostrea_gigas_v9_tracks_1A7C193F.pngCrassostrea_gigas_v9_tracks_1A7C193F.png 44KB Jan 30 2015 11:55:44 AMCrassostrea_gigas_v9_tracks_1A7C193F.png
Creating_Things_1A576087.pngCreating_Things_1A576087.png 70KB Jan 02 2015 03:25:59 PMCreating_Things_1A576087.png
Cufflinks_1AD2D9F7.pngCufflinks_1AD2D9F7.png 163KB Apr 06 2015 08:12:56 AMCufflinks_1AD2D9F7.png
cytoplasmic_pattern_recognition_receptor_signaling_pathway_in____-_BioSystems_-_NCBI_199D833D.pngcytoplasmic_pattern_recognition_receptor... 98KB Aug 14 2014 04:52:31 PMcytoplasmic_pattern_recognition_receptor_signaling_pathway_in____-_BioSystems_-_NCBI_199D833D.png
cy_1CEA6C82.pngcy_1CEA6C82.png 42KB May 16 2016 02:00:50 PMcy_1CEA6C82.png
C_virginica_1_0_-_Assembly_-_NCBI_1E7B31EB.pngC_virginica_1_0_-_Assembly_-_NCBI_1E7B31... 279KB Mar 16 2017 01:49:48 PMC_virginica_1_0_-_Assembly_-_NCBI_1E7B31EB.png
danger_-_Google_Search_1981A7BA.pngdanger_-_Google_Search_1981A7BA.png 94KB Jul 24 2014 01:44:43 PMdanger_-_Google_Search_1981A7BA.png
danger_-_Google_Search_1981A778.pngdanger_-_Google_Search_1981A778.png 97KB Jul 24 2014 01:43:38 PMdanger_-_Google_Search_1981A778.png
data_1A964E14.pngdata_1A964E14.png 191KB Feb 19 2015 09:00:04 AMdata_1A964E14.png
Data_from__Phylogenomic_analyses_reveal_latitudinal_population_structure_and_polymorphisms_in_heat_stress_genes_in_the_North_Atlantic_snail_Nucella_lapillus_-_Dryad_1A6465D3.pngData_from__Phylogenomic_analyses_reveal_... 32KB Jan 12 2015 12:28:02 PMData_from__Phylogenomic_analyses_reveal_latitudinal_population_structure_and_polymorphisms_in_heat_stress_genes_in_the_North_Atlantic_snail_Nucella_lapillus_-_Dryad_1A6465D3.png
Data_from__Phylogenomic_analyses_reveal_latitudinal_population_structure_and_polymorphisms_in_heat_stress_genes_in_the_North_Atlantic_snail_Nucella_lapillus_-_Dryad_1A6465E4.pngData_from__Phylogenomic_analyses_reveal_... 53KB Jan 12 2015 12:28:19 PMData_from__Phylogenomic_analyses_reveal_latitudinal_population_structure_and_polymorphisms_in_heat_stress_genes_in_the_North_Atlantic_snail_Nucella_lapillus_-_Dryad_1A6465E4.png
Data_Received_–_Ostrea_lurida_genome_sequencing_files_from_BGI___Sam_s_Notebook_1C66923F.pngData_Received_–_Ostrea_lurida_genome_s... 33KB Feb 06 2016 12:42:41 PMData_Received_–_Ostrea_lurida_genome_sequencing_files_from_BGI___Sam_s_Notebook_1C66923F.png
Data_Snapshots_·_sr320_qdod_Wiki_1AB7460C.pngData_Snapshots_·_sr320_qdod_Wiki_1AB746... 118KB Mar 16 2015 10:10:36 AMData_Snapshots_·_sr320_qdod_Wiki_1AB7460C.png
david2_17CD15E1.pngdavid2_17CD15E1.png 455KB Aug 27 2013 10:22:11 AMdavid2_17CD15E1.png
david_17CD1513.pngdavid_17CD1513.png 444KB Aug 27 2013 10:18:45 AMdavid_17CD1513.png
DAVID_Functional_Annotation_Table_-__DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Scienc_1DDE46A4.pngDAVID_Functional_Annotation_Table_-__DAV... 92KB Nov 17 2016 12:12:20 PMDAVID_Functional_Annotation_Table_-__DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Scienc_1DDE46A4.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1A7034F3.pngDAVID__Database_for_Annotation__Visualiz... 133KB Jan 21 2015 11:26:56 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1A7034F3.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_17CEA901.DAVID__Database_for_Annotation__Visualiz... 196KB Aug 28 2013 03:02:15 PM
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_17E9F314.DAVID__Database_for_Annotation__Visualiz... 62KB Sep 18 2013 07:41:24 AM
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_17F07A97.DAVID__Database_for_Annotation__Visualiz... 97KB Sep 23 2013 06:33:12 AM
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_17F07CA9.DAVID__Database_for_Annotation__Visualiz... 111KB Sep 23 2013 06:42:02 AM
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_18A6AD53.pngDAVID__Database_for_Annotation__Visualiz... 123KB Feb 08 2014 10:24:25 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_18A6AD53.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D5ECA.pngDAVID__Database_for_Annotation__Visualiz... 127KB Jul 21 2014 07:44:27 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D5ECA.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D5F03.pngDAVID__Database_for_Annotation__Visualiz... 81KB Jul 21 2014 07:45:24 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D5F03.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D5F4F.pngDAVID__Database_for_Annotation__Visualiz... 56KB Jul 21 2014 07:46:41 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D5F4F.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D5F19.pngDAVID__Database_for_Annotation__Visualiz... 81KB Jul 21 2014 07:45:46 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D5F19.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D62DE.pngDAVID__Database_for_Annotation__Visualiz... 108KB Jul 21 2014 08:01:51 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D62DE.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D63B0.pngDAVID__Database_for_Annotation__Visualiz... 59KB Jul 21 2014 08:05:21 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D63B0.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D63DB.pngDAVID__Database_for_Annotation__Visualiz... 78KB Jul 21 2014 08:06:03 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D63DB.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D606C.pngDAVID__Database_for_Annotation__Visualiz... 113KB Jul 21 2014 07:51:25 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D606C.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D609F.pngDAVID__Database_for_Annotation__Visualiz... 98KB Jul 21 2014 07:52:16 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D609F.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D631B.pngDAVID__Database_for_Annotation__Visualiz... 36KB Jul 21 2014 08:02:52 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D631B.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D6031.pngDAVID__Database_for_Annotation__Visualiz... 81KB Jul 21 2014 07:50:26 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D6031.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D6071.pngDAVID__Database_for_Annotation__Visualiz... 113KB Jul 21 2014 07:51:30 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D6071.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D6353.pngDAVID__Database_for_Annotation__Visualiz... 96KB Jul 21 2014 08:03:48 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D6353.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D6408.pngDAVID__Database_for_Annotation__Visualiz... 81KB Jul 21 2014 08:06:49 AMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_197D6408.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1958D206.pngDAVID__Database_for_Annotation__Visualiz... 145KB Jun 23 2014 02:22:17 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1958D206.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1992E9A8.pngDAVID__Database_for_Annotation__Visualiz... 126KB Aug 06 2014 03:54:32 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1992E9A8.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1992E9AE.pngDAVID__Database_for_Annotation__Visualiz... 126KB Aug 06 2014 03:54:38 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1992E9AE.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1992E98D.pngDAVID__Database_for_Annotation__Visualiz... 120KB Aug 06 2014 03:54:06 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1992E98D.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957B66.pngDAVID__Database_for_Annotation__Visualiz... 67KB Aug 08 2014 02:40:55 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957B66.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957BA8.pngDAVID__Database_for_Annotation__Visualiz... 113KB Aug 08 2014 02:42:00 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957BA8.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957C24.pngDAVID__Database_for_Annotation__Visualiz... 39KB Aug 08 2014 02:44:05 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957C24.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957D08.pngDAVID__Database_for_Annotation__Visualiz... 53KB Aug 08 2014 02:47:53 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957D08.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957D2A.pngDAVID__Database_for_Annotation__Visualiz... 54KB Aug 08 2014 02:48:27 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957D2A.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957EB2.pngDAVID__Database_for_Annotation__Visualiz... 147KB Aug 08 2014 02:54:59 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957EB2.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957F1E.pngDAVID__Database_for_Annotation__Visualiz... 47KB Aug 08 2014 02:56:47 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19957F1E.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19958D94.pngDAVID__Database_for_Annotation__Visualiz... 99KB Aug 08 2014 03:58:28 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19958D94.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19958F18.pngDAVID__Database_for_Annotation__Visualiz... 99KB Aug 08 2014 04:04:57 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19958F18.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_199581A4.pngDAVID__Database_for_Annotation__Visualiz... 169KB Aug 08 2014 03:07:33 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_199581A4.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_199583A3.pngDAVID__Database_for_Annotation__Visualiz... 90KB Aug 08 2014 03:16:03 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_199583A3.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_199591A8.pngDAVID__Database_for_Annotation__Visualiz... 125KB Aug 08 2014 04:15:53 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_199591A8.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_199591ED.pngDAVID__Database_for_Annotation__Visualiz... 98KB Aug 08 2014 04:17:01 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_199591ED.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_199591FB.pngDAVID__Database_for_Annotation__Visualiz... 98KB Aug 08 2014 04:17:15 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_199591FB.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1995776F.pngDAVID__Database_for_Annotation__Visualiz... 128KB Aug 08 2014 02:24:00 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1995776F.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1995799C.pngDAVID__Database_for_Annotation__Visualiz... 143KB Aug 08 2014 02:33:17 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1995799C.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1995919D.pngDAVID__Database_for_Annotation__Visualiz... 125KB Aug 08 2014 04:15:47 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_1995919D.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19958439.pngDAVID__Database_for_Annotation__Visualiz... 96KB Aug 08 2014 03:18:34 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19958439.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19958660.pngDAVID__Database_for_Annotation__Visualiz... 118KB Aug 08 2014 03:27:46 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19958660.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19959167.pngDAVID__Database_for_Annotation__Visualiz... 125KB Aug 08 2014 04:14:48 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19959167.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19959404.pngDAVID__Database_for_Annotation__Visualiz... 123KB Aug 08 2014 04:25:57 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19959404.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19959411.pngDAVID__Database_for_Annotation__Visualiz... 123KB Aug 08 2014 04:26:09 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19959411.png
DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19959539.pngDAVID__Database_for_Annotation__Visualiz... 123KB Aug 08 2014 04:31:05 PMDAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_International_Corporat_19959539.png
DAVID__Functional_Annotation_Result_Summary_1992E939.pngDAVID__Functional_Annotation_Result_Summ... 149KB Aug 06 2014 03:52:42 PMDAVID__Functional_Annotation_Result_Summary_1992E939.png
DAVID__Functional_Annotation_Result_Summary_19958180.pngDAVID__Functional_Annotation_Result_Summ... 83KB Aug 08 2014 03:06:57 PMDAVID__Functional_Annotation_Result_Summary_19958180.png
DAVID__Functional_Annotation_Result_Summary_19958380.pngDAVID__Functional_Annotation_Result_Summ... 95KB Aug 08 2014 03:15:29 PMDAVID__Functional_Annotation_Result_Summary_19958380.png
DAVID__Functional_Annotation_Result_Summary_19958417.pngDAVID__Functional_Annotation_Result_Summ... 56KB Aug 08 2014 03:17:59 PMDAVID__Functional_Annotation_Result_Summary_19958417.png
DAVID__Functional_Annotation_Tools_1A7033CD.pngDAVID__Functional_Annotation_Tools_1A703... 69KB Jan 21 2015 11:22:01 AMDAVID__Functional_Annotation_Tools_1A7033CD.png
DAVID__Functional_Annotation_Tools_1A7034CA.pngDAVID__Functional_Annotation_Tools_1A703... 69KB Jan 21 2015 11:26:15 AMDAVID__Functional_Annotation_Tools_1A7034CA.png
DAVID__Functional_Annotation_Tools_18A6ABB3.pngDAVID__Functional_Annotation_Tools_18A6A... 85KB Feb 08 2014 10:17:28 AMDAVID__Functional_Annotation_Tools_18A6ABB3.png
DAVID__Functional_Annotation_Tools_18A6AD0F.pngDAVID__Functional_Annotation_Tools_18A6A... 42KB Feb 08 2014 10:23:16 AMDAVID__Functional_Annotation_Tools_18A6AD0F.png
DAVID__Functional_Annotation_Tools_1992E7DC.pngDAVID__Functional_Annotation_Tools_1992E... 129KB Aug 06 2014 03:46:52 PMDAVID__Functional_Annotation_Tools_1992E7DC.png
DAVID__Functional_Annotation_Tools_19957533.pngDAVID__Functional_Annotation_Tools_19957... 129KB Aug 08 2014 02:14:28 PMDAVID__Functional_Annotation_Tools_19957533.png
DAVID__Gene_Functional_Classification_19959263.pngDAVID__Gene_Functional_Classification_19... 129KB Aug 08 2014 04:19:00 PMDAVID__Gene_Functional_Classification_19959263.png
Defense_Week__From_Frozen_Sperm_to_Acidified_Oysters___Roberts_Lab_18A6E2B5.pngDefense_Week__From_Frozen_Sperm_to_Acidi... 81KB Feb 08 2014 02:12:11 PMDefense_Week__From_Frozen_Sperm_to_Acidified_Oysters___Roberts_Lab_18A6E2B5.png
Defense_Week__From_Frozen_Sperm_to_Acidified_Oysters___Roberts_Lab_18A6E2E7.pngDefense_Week__From_Frozen_Sperm_to_Acidi... 81KB Feb 08 2014 02:13:00 PMDefense_Week__From_Frozen_Sperm_to_Acidified_Oysters___Roberts_Lab_18A6E2E7.png
Delta_-_Book_a_flight_17E24F36.pngDelta_-_Book_a_flight_17E24F36.png 235KB Sep 12 2013 12:36:24 PMDelta_-_Book_a_flight_17E24F36.png
Delta_-_Book_a_flight_17E255D7.pngDelta_-_Book_a_flight_17E255D7.png 236KB Sep 12 2013 01:04:41 PMDelta_-_Book_a_flight_17E255D7.png
Description_-_Austral_Summer_Institute_XV_1A56F09F.pngDescription_-_Austral_Summer_Institute_X... 9KB Jan 02 2015 07:28:32 AMDescription_-_Austral_Summer_Institute_XV_1A56F09F.png
Desktop_1E3EB24F.pngDesktop_1E3EB24F.png 35KB Jan 29 2017 03:29:20 PMDesktop_1E3EB24F.png
Developing_CpG_O_E_Workflow___half-shell_1A7E8AA8.pngDeveloping_CpG_O_E_Workflow___half-shell... 49KB Feb 01 2015 08:24:10 AMDeveloping_CpG_O_E_Workflow___half-shell_1A7E8AA8.png
DIA-2_6_pdf_1D9EDC33.pngDIA-2_6_pdf_1D9EDC33.png 68KB Sep 30 2016 10:45:24 AMDIA-2_6_pdf_1D9EDC33.png
DIA-2_6_pdf_1D9EDCE1.pngDIA-2_6_pdf_1D9EDCE1.png 91KB Sep 30 2016 10:48:18 AMDIA-2_6_pdf_1D9EDCE1.png
Directory_Listing_of__trilobite_Crassostrea_gigas_HTSdata_batterbox_FCC39KL_Sample_Y38_control__18C7D022.pngDirectory_Listing_of__trilobite_Crassost... 27KB Mar 05 2014 01:35:33 PMDirectory_Listing_of__trilobite_Crassostrea_gigas_HTSdata_batterbox_FCC39KL_Sample_Y38_control__18C7D022.png
Directory_Listing_of__trilobite_Crassostrea_gigas_HTSdata_batterbox_FCC39KL__18C7CFBC.pngDirectory_Listing_of__trilobite_Crassost... 29KB Mar 05 2014 01:33:51 PMDirectory_Listing_of__trilobite_Crassostrea_gigas_HTSdata_batterbox_FCC39KL__18C7CFBC.png
Discovery_Environment_1A38D523.pngDiscovery_Environment_1A38D523.png 175KB Dec 10 2014 11:23:18 AMDiscovery_Environment_1A38D523.png
Discovery_Environment_1A38FA3C.pngDiscovery_Environment_1A38FA3C.png 98KB Dec 10 2014 02:01:39 PMDiscovery_Environment_1A38FA3C.png
Discovery_Environment_1DB540BE.pngDiscovery_Environment_1DB540BE.png 107KB Oct 17 2016 10:24:16 AMDiscovery_Environment_1DB540BE.png
Discovery_Environment_and_sr320_course-fish546-2016_1DB66BA1.pngDiscovery_Environment_and_sr320_course-f... 162KB Oct 18 2016 07:39:35 AMDiscovery_Environment_and_sr320_course-fish546-2016_1DB66BA1.png
Discovery_Environment___CyVerse_1DA44227.pngDiscovery_Environment___CyVerse_1DA44227... 260KB Oct 04 2016 01:01:49 PMDiscovery_Environment___CyVerse_1DA44227.png
DMR_1E328003.pngDMR_1E328003.png 58KB Jan 20 2017 09:27:33 AMDMR_1E328003.png
DNA_Isolation_–_Olympia_oyster_whole_body___Sam_s_Notebook_1BAB13A3.pngDNA_Isolation_–_Olympia_oyster_whole_b... 221KB Sep 17 2015 08:28:34 AMDNA_Isolation_–_Olympia_oyster_whole_body___Sam_s_Notebook_1BAB13A3.png
DNA_Isolation_–_Oly_gDNA_for_BS-seq___Sam_s_Notebook_1C50508C.pngDNA_Isolation_–_Oly_gDNA_for_BS-seq___... 22KB Jan 20 2016 03:32:29 PMDNA_Isolation_–_Oly_gDNA_for_BS-seq___Sam_s_Notebook_1C50508C.png
DNA_methylation_patterns_provide_insight_into_epigenetic_regulation_in_the_Pacific_oyster__Crassostrea_gigas____BMC_Genomics___Full_Text_1DF9C6ED.pngDNA_methylation_patterns_provide_insight... 97KB Dec 08 2016 08:50:55 AMDNA_methylation_patterns_provide_insight_into_epigenetic_regulation_in_the_Pacific_oyster__Crassostrea_gigas____BMC_Genomics___Full_Text_1DF9C6ED.png
Downloads_STRING__functional_protein_association_networks_17DBA6A3.pngDownloads_STRING__functional_protein_ass... 152KB Sep 07 2013 11:32:12 AMDownloads_STRING__functional_protein_association_networks_17DBA6A3.png
Downloads___EchinoBase_1AFC08C4.pngDownloads___EchinoBase_1AFC08C4.png 300KB May 07 2015 01:55:33 PMDownloads___EchinoBase_1AFC08C4.png
Downloads___EchinoBase_19D1CFB5.pngDownloads___EchinoBase_19D1CFB5.png 361KB Sep 23 2014 08:56:38 AMDownloads___EchinoBase_19D1CFB5.png
Downloads___EchinoBase_199E3437.pngDownloads___EchinoBase_199E3437.png 278KB Aug 15 2014 05:27:36 AMDownloads___EchinoBase_199E3437.png
Download_18EEEAB9.pngDownload_18EEEAB9.png 76KB Apr 04 2014 06:27:23 AMDownload_18EEEAB9.png
Download_187DDB0F.pngDownload_187DDB0F.png 147KB Jan 08 2014 11:14:24 AMDownload_187DDB0F.png
Download_19911681.pngDownload_19911681.png 93KB Aug 05 2014 06:41:22 AMDownload_19911681.png
Download_Anaconda_Python_Distribution_-_Google_Chrome_1BB9A1AE.pngDownload_Anaconda_Python_Distribution_-_... 131KB Sep 28 2015 09:26:23 AMDownload_Anaconda_Python_Distribution_-_Google_Chrome_1BB9A1AE.png
Download__Pinctada_Fucata_Genome_Ver_1_00_1AF29B7B.pngDownload__Pinctada_Fucata_Genome_Ver_1_0... 187KB Apr 30 2015 10:18:52 AMDownload__Pinctada_Fucata_Genome_Ver_1_00_1AF29B7B.png
Download__Pinctada_Fucata_Genome_Ver_1_00_1AF29CD0.pngDownload__Pinctada_Fucata_Genome_Ver_1_0... 187KB Apr 30 2015 10:24:33 AMDownload__Pinctada_Fucata_Genome_Ver_1_00_1AF29CD0.png
DRAFT_of_the_Graduation_Program_-_roberts_sbr_gmail_com_-_Gmail_1B274C39.pngDRAFT_of_the_Graduation_Program_-_robert... 117KB Jun 09 2015 09:30:49 AMDRAFT_of_the_Graduation_Program_-_roberts_sbr_gmail_com_-_Gmail_1B274C39.png
DRAFT_of_the_Graduation_Program_-_roberts_sbr_gmail_com_-_Gmail_1B274CEE.pngDRAFT_of_the_Graduation_Program_-_robert... 6KB Jun 09 2015 09:33:50 AMDRAFT_of_the_Graduation_Program_-_roberts_sbr_gmail_com_-_Gmail_1B274CEE.png
Draft_Olympia_Oyster_md_1C6A4A33.pngDraft_Olympia_Oyster_md_1C6A4A33.png 26KB Feb 09 2016 08:24:23 AMDraft_Olympia_Oyster_md_1C6A4A33.png
Drive_storage_1B1F4704.pngDrive_storage_1B1F4704.png 68KB Jun 03 2015 07:30:29 AMDrive_storage_1B1F4704.png
Dropbox_-_PPTs_1A726A5D.pngDropbox_-_PPTs_1A726A5D.png 16KB Jan 23 2015 03:39:13 AMDropbox_-_PPTs_1A726A5D.png
Durafet_protocol_1C6A5E91.pngDurafet_protocol_1C6A5E91.png 269KB Feb 09 2016 09:51:17 AMDurafet_protocol_1C6A5E91.png
eagle.fish.washington.edu_bivalvia_GIA_2013_Gavery.pdf_17D50AB1.pngeagle.fish.washington.edu_bivalvia_GIA_2... 149KB Sep 02 2013 11:12:57 AMeagle.fish.washington.edu_bivalvia_GIA_2013_Gavery.pdf_17D50AB1.png
eagle.fish.washington.edu_cnidarian_BiGo_prom_subgene_CGcount.txt_17E2745E.pngeagle.fish.washington.edu_cnidarian_BiGo... 23KB Sep 12 2013 03:14:57 PMeagle.fish.washington.edu_cnidarian_BiGo_prom_subgene_CGcount.txt_17E2745E.png
eagle.fish.washington.edu_cnidarian_OlyO_trans_v3_swissprot_test2.txt_17F2041A.pngeagle.fish.washington.edu_cnidarian_OlyO... 23KB Sep 24 2013 10:32:33 AMeagle.fish.washington.edu_cnidarian_OlyO_trans_v3_swissprot_test2.txt_17F2041A.png
eagle_fish_washington_edu_cnidarian_olson-ms-nb-master_12_1714_wd_all_CGs_1BC3F807.pngeagle_fish_washington_edu_cnidarian_olso... 15KB Oct 06 2015 05:37:40 AMeagle_fish_washington_edu_cnidarian_olson-ms-nb-master_12_1714_wd_all_CGs_1BC3F807.png
eagle_fish_washington_edu_cnidarian_olson-ms-nb-master_12_1714_wd_developmental_DMLs_1BC3F775.pngeagle_fish_washington_edu_cnidarian_olso... 15KB Oct 06 2015 05:35:12 AMeagle_fish_washington_edu_cnidarian_olson-ms-nb-master_12_1714_wd_developmental_DMLs_1BC3F775.png
eagle_fish_washington_edu_cnidarian_olson-ms-nb-master_12_1714_wd_lineage_DMLs_1BC2FE65.pngeagle_fish_washington_edu_cnidarian_olso... 14KB Oct 05 2015 11:52:22 AMeagle_fish_washington_edu_cnidarian_olson-ms-nb-master_12_1714_wd_lineage_DMLs_1BC2FE65.png
eagle_fish_washington_edu_cnidarian_olson-ms-nb-master_12_1714_wd_lintable_1BC2FE30.pngeagle_fish_washington_edu_cnidarian_olso... 11KB Oct 05 2015 11:51:29 AMeagle_fish_washington_edu_cnidarian_olson-ms-nb-master_12_1714_wd_lintable_1BC2FE30.png
eagle_fish_washington_edu_trilobite_Proposal_Database_OlyNOAA_2013_pdf_1AD450B9.pngeagle_fish_washington_edu_trilobite_Prop... 581KB Apr 07 2015 10:51:54 AMeagle_fish_washington_edu_trilobite_Proposal_Database_OlyNOAA_2013_pdf_1AD450B9.png
eagle_fish_washington_edu_trilobite_Proposal_Database_OlyNOAA_2013_pdf_1AD4500F.pngeagle_fish_washington_edu_trilobite_Prop... 64KB Apr 07 2015 10:49:04 AMeagle_fish_washington_edu_trilobite_Proposal_Database_OlyNOAA_2013_pdf_1AD4500F.png
eagle_fish_washington_edu_trilobite_Proposal_Database_OlyNOAA_2013_pdf_1AD45057.pngeagle_fish_washington_edu_trilobite_Prop... 64KB Apr 07 2015 10:50:15 AMeagle_fish_washington_edu_trilobite_Proposal_Database_OlyNOAA_2013_pdf_1AD45057.png
eimd-sswd_eimd_analysis_ipynb_at_master_·_sr320_eimd-sswd_1B55A611.pngeimd-sswd_eimd_analysis_ipynb_at_master_... 91KB Jul 14 2015 01:18:11 PMeimd-sswd_eimd_analysis_ipynb_at_master_·_sr320_eimd-sswd_1B55A611.png
eimd-sswd_eimd_analysis_ipynb_at_master_·_sr320_eimd-sswd_1DC23A83.pngeimd-sswd_eimd_analysis_ipynb_at_master_... 48KB Oct 27 2016 06:37:08 AMeimd-sswd_eimd_analysis_ipynb_at_master_·_sr320_eimd-sswd_1DC23A83.png
eimd-sswd_Phel_transcriptome_fasta_at_master_·_sr320_eimd-sswd_and_git-repos_1DC2B162.pngeimd-sswd_Phel_transcriptome_fasta_at_ma... 140KB Oct 27 2016 03:04:20 PMeimd-sswd_Phel_transcriptome_fasta_at_master_·_sr320_eimd-sswd_and_git-repos_1DC2B162.png
eimd-sswd_v1_0__Supplemental_Jupyter_notebooks_and_data_1BBEF7E6.pngeimd-sswd_v1_0__Supplemental_Jupyter_not... 111KB Oct 02 2015 10:35:35 AMeimd-sswd_v1_0__Supplemental_Jupyter_notebooks_and_data_1BBEF7E6.png
eimd-sswd_v1_0__Supplemental_Jupyter_notebooks_and_data_1BBEF7FB.pngeimd-sswd_v1_0__Supplemental_Jupyter_not... 111KB Oct 02 2015 10:35:56 AMeimd-sswd_v1_0__Supplemental_Jupyter_notebooks_and_data_1BBEF7FB.png
EMBOSS__fuzznuc_1DDE4663.pngEMBOSS__fuzznuc_1DDE4663.png 119KB Nov 17 2016 12:11:17 PMEMBOSS__fuzznuc_1DDE4663.png
Employee_Self-Service_1A5B190B.pngEmployee_Self-Service_1A5B190B.png 57KB Jan 05 2015 11:10:03 AMEmployee_Self-Service_1A5B190B.png
Ensembl_Genomes__Crassostrea_gigas_-_Details_189FE9C0.pngEnsembl_Genomes__Crassostrea_gigas_-_Det... 48KB Feb 03 2014 07:16:03 AMEnsembl_Genomes__Crassostrea_gigas_-_Details_189FE9C0.png
EPI-135_S35_L005_R1_001_val_1_fq_gz_FastQC_Report_1EF81460.pngEPI-135_S35_L005_R1_001_val_1_fq_gz_Fast... 42KB Jun 19 2017 07:17:08 AMEPI-135_S35_L005_R1_001_val_1_fq_gz_FastQC_Report_1EF81460.png
Evernote_17F39293.pngEvernote_17F39293.png 16KB Sep 25 2013 02:52:21 PMEvernote_17F39293.png
Evernote_Premium_1A4A122E.pngEvernote_Premium_1A4A122E.png 436KB Dec 23 2014 01:12:20 PMEvernote_Premium_1A4A122E.png
Evernote_Premium_1A9FE4A4.pngEvernote_Premium_1A9FE4A4.png 421KB Feb 26 2015 03:32:53 PMEvernote_Premium_1A9FE4A4.png
Evidence_of_Ostrea_lurida__Carpenter_1864__population_structure_in_Puget_Sound__WA__PeerJ_PrePrints__1BC01888.pngEvidence_of_Ostrea_lurida__Carpenter_186... 57KB Oct 03 2015 07:07:06 AMEvidence_of_Ostrea_lurida__Carpenter_1864__population_structure_in_Puget_Sound__WA__PeerJ_PrePrints__1BC01888.png
exclde_18A6AEF4.pngexclde_18A6AEF4.png 322KB Feb 08 2014 10:31:23 AMexclde_18A6AEF4.png
Experiment_SRX807405___Submit___Sequence_Read_Archive___NCBI_NLM_NIH_v_0_7_2_1A3B4EC5.pngExperiment_SRX807405___Submit___Sequence... 98KB Dec 12 2014 08:26:46 AMExperiment_SRX807405___Submit___Sequence_Read_Archive___NCBI_NLM_NIH_v_0_7_2_1A3B4EC5.png
Experiment___Submit___Sequence_Read_Archive___NCBI_NLM_NIH_v_0_7_2_1A3B4739.pngExperiment___Submit___Sequence_Read_Arch... 103KB Dec 12 2014 07:54:34 AMExperiment___Submit___Sequence_Read_Archive___NCBI_NLM_NIH_v_0_7_2_1A3B4739.png
faculty.washington.edu_banasn_bering_Banas_traitworkshop_poster.pdf_18043925.pngfaculty.washington.edu_banasn_bering_Ban... 167KB Oct 08 2013 05:59:17 AMfaculty.washington.edu_banasn_bering_Banas_traitworkshop_poster.pdf_18043925.png
faculty_washington_edu_sr320_wordpress_wp-content_uploads_2012_03_Meztger_JSR_pdf_1A016ED8.pngfaculty_washington_edu_sr320_wordpress_w... 50KB Oct 29 2014 11:52:09 AMfaculty_washington_edu_sr320_wordpress_wp-content_uploads_2012_03_Meztger_JSR_pdf_1A016ED8.png
FastQC_1BDC334F.pngFastQC_1BDC334F.png 37KB Oct 24 2015 02:44:48 PMFastQC_1BDC334F.png
FastQC_18EC6333.pngFastQC_18EC6333.png 56KB Apr 02 2014 08:24:36 AMFastQC_18EC6333.png
FastQC_18EC6477.pngFastQC_18EC6477.png 68KB Apr 02 2014 08:30:00 AMFastQC_18EC6477.png
FastQC_18EC6493.pngFastQC_18EC6493.png 68KB Apr 02 2014 08:30:29 AMFastQC_18EC6493.png
fastq_quality_filter_out_fastq_FastQC_Report_18E0DD4F.pngfastq_quality_filter_out_fastq_FastQC_Re... 80KB Mar 24 2014 02:38:24 PMfastq_quality_filter_out_fastq_FastQC_Report_18E0DD4F.png
fG03_s1_40x_jpg__3_documents__3_total_pages__1D75E758.pngfG03_s1_40x_jpg__3_documents__3_total_pa... 79KB Aug 30 2016 09:10:03 AMfG03_s1_40x_jpg__3_documents__3_total_pages__1D75E758.png
fG04_s1_40x_jpg_1D75E7D7.pngfG04_s1_40x_jpg_1D75E7D7.png 85KB Aug 30 2016 09:12:07 AMfG04_s1_40x_jpg_1D75E7D7.png
fG08_s1_40x_jpg_1D75E833.pngfG08_s1_40x_jpg_1D75E833.png 72KB Aug 30 2016 09:13:40 AMfG08_s1_40x_jpg_1D75E833.png
FieldWork__2__jpg_1BD04567.pngFieldWork__2__jpg_1BD04567.png 60KB Oct 15 2015 01:34:52 PMFieldWork__2__jpg_1BD04567.png
Fig1SSWD__1__tiff_1B55A7AA.pngFig1SSWD__1__tiff_1B55A7AA.png 143KB Jul 14 2015 01:25:00 PMFig1SSWD__1__tiff_1B55A7AA.png
Fig1_png__7_documents__7_total_pages__1E08403E.pngFig1_png__7_documents__7_total_pages__1E... 246KB Dec 19 2016 08:20:17 AMFig1_png__7_documents__7_total_pages__1E08403E.png
Fig7_pdf__1_page___7_documents__7_total_pages__1E084173.pngFig7_pdf__1_page___7_documents__7_total_... 227KB Dec 19 2016 08:25:24 AMFig7_pdf__1_page___7_documents__7_total_pages__1E084173.png
Fig7_pdf__1_page___7_documents__7_total_pages__1E0851EA.pngFig7_pdf__1_page___7_documents__7_total_... 227KB Dec 19 2016 09:35:39 AMFig7_pdf__1_page___7_documents__7_total_pages__1E0851EA.png
Figure_3__2___1__tif_1B163B69.pngFigure_3__2___1__tif_1B163B69.png 546KB May 27 2015 10:50:33 AMFigure_3__2___1__tif_1B163B69.png
Figure_3__2___1__tif_1B558324.pngFigure_3__2___1__tif_1B558324.png 35KB Jul 14 2015 10:49:11 AMFigure_3__2___1__tif_1B558324.png
Figure_4__2___1__tiff_1B163AEE.pngFigure_4__2___1__tiff_1B163AEE.png 259KB May 27 2015 10:48:31 AMFigure_4__2___1__tiff_1B163AEE.png
fig_1889D7CF.pngfig_1889D7CF.png 13KB Jan 17 2014 01:28:43 PMfig_1889D7CF.png
Filesarr_1E356F8A.pngFilesarr_1E356F8A.png 95KB Jan 22 2017 02:54:04 PMFilesarr_1E356F8A.png
Files_1E356C08.pngFiles_1E356C08.png 88KB Jan 22 2017 02:39:09 PMFiles_1E356C08.png
Files_and_Directories_1A575CA9.pngFiles_and_Directories_1A575CA9.png 11KB Jan 02 2015 03:09:30 PMFiles_and_Directories_1A575CA9.png
Files_and_Directories_1A575CC7.pngFiles_and_Directories_1A575CC7.png 17KB Jan 02 2015 03:10:00 PMFiles_and_Directories_1A575CC7.png
Files_and_Directories_1A575D2F.pngFiles_and_Directories_1A575D2F.png 22KB Jan 02 2015 03:11:44 PMFiles_and_Directories_1A575D2F.png
Files_and_Directories_1A575F8C.pngFiles_and_Directories_1A575F8C.png 9KB Jan 02 2015 03:21:48 PMFiles_and_Directories_1A575F8C.png
Files_and_Directories_1A575F26.pngFiles_and_Directories_1A575F26.png 24KB Jan 02 2015 03:20:06 PMFiles_and_Directories_1A575F26.png
Files_🔊_1CA9BAA4.pngFiles_🔊_1CA9BAA4.png 28KB Mar 28 2016 12:16:56 PMFiles_🔊_1CA9BAA4.png
file_1DECE066.pngfile_1DECE066.png 32KB Nov 28 2016 02:00:07 PMfile_1DECE066.png
file_1DECE2AB.pngfile_1DECE2AB.png 163KB Nov 28 2016 02:09:47 PMfile_1DECE2AB.png
file_1DECE2BB.pngfile_1DECE2BB.png 86KB Nov 28 2016 02:10:04 PMfile_1DECE2BB.png
file_1DECE2D2.pngfile_1DECE2D2.png 48KB Nov 28 2016 02:10:27 PMfile_1DECE2D2.png
file_1DECE2F0.pngfile_1DECE2F0.png 65KB Nov 28 2016 02:10:57 PMfile_1DECE2F0.png
file_1DECE30B.pngfile_1DECE30B.png 81KB Nov 28 2016 02:11:23 PMfile_1DECE30B.png
file_1DECE38B.pngfile_1DECE38B.png 125KB Nov 28 2016 02:13:32 PMfile_1DECE38B.png
file_1DECE285.pngfile_1DECE285.png 47KB Nov 28 2016 02:09:10 PMfile_1DECE285.png
file_1DECE352.pngfile_1DECE352.png 125KB Nov 28 2016 02:12:35 PMfile_1DECE352.png
File_196B2C85.pngFile_196B2C85.png 106KB Jul 07 2014 12:29:11 PMFile_196B2C85.png
filtered_Y54_Mix_GTGGCC_L005_R1_fastq_FastQC_Report_193E7D6C.pngfiltered_Y54_Mix_GTGGCC_L005_R1_fastq_Fa... 80KB Jun 03 2014 03:02:21 PMfiltered_Y54_Mix_GTGGCC_L005_R1_fastq_FastQC_Report_193E7D6C.png
filtered_Y54_Mix_GTGGCC_L005_R2_fastq_FastQC_Report_193E7D24.pngfiltered_Y54_Mix_GTGGCC_L005_R2_fastq_Fa... 65KB Jun 03 2014 03:01:10 PMfiltered_Y54_Mix_GTGGCC_L005_R2_fastq_FastQC_Report_193E7D24.png
First_steps_at_an_aggregated_view_of_all_DNA_methylation_data__updated____half-shell_1C609E2D.pngFirst_steps_at_an_aggregated_view_of_all... 80KB Feb 02 2016 12:20:03 AMFirst_steps_at_an_aggregated_view_of_all_DNA_methylation_data__updated____half-shell_1C609E2D.png
Fish-546-Bioinformatics_README_md_at_V3_0_·_Ellior2_Fish-546-Bioinformatics_1E08531E.pngFish-546-Bioinformatics_README_md_at_V3_... 258KB Dec 19 2016 09:40:46 AMFish-546-Bioinformatics_README_md_at_V3_0_·_Ellior2_Fish-546-Bioinformatics_1E08531E.png
FISH-546_01-coge_ipynb_at_master_·_MeganEDuffy_FISH-546_1DDA27F7.pngFISH-546_01-coge_ipynb_at_master_·_Mega... 120KB Nov 14 2016 09:12:25 AMFISH-546_01-coge_ipynb_at_master_·_MeganEDuffy_FISH-546_1DDA27F7.png
fish441_1A0152B0.pngfish441_1A0152B0.png 122KB Oct 29 2014 09:52:01 AMfish441_1A0152B0.png
fish546-2015_Jay-join_ipynb_at_master_·_sr320_fish546-2015_1D4BB702.pngfish546-2015_Jay-join_ipynb_at_master_·... 36KB Jul 29 2016 09:08:39 AMfish546-2015_Jay-join_ipynb_at_master_·_sr320_fish546-2015_1D4BB702.png
fish546_2015_gigasHSrnaSeq_analysis_at_master_·_kubu4_fish546_2015_1A7985F8.pngfish546_2015_gigasHSrnaSeq_analysis_at_m... 27KB Jan 28 2015 01:02:50 PMfish546_2015_gigasHSrnaSeq_analysis_at_master_·_kubu4_fish546_2015_1A7985F8.png
FISH546_Cod-Time-Series-Project_at_master_·_nclowell_FISH546_1E084D06.pngFISH546_Cod-Time-Series-Project_at_maste... 97KB Dec 19 2016 09:14:47 AMFISH546_Cod-Time-Series-Project_at_master_·_nclowell_FISH546_1E084D06.png
FISH546_Cod-Time-Series-Project_Genepop_Results_ipynb_at_master_·_nclowell_FISH546_1E084C1D.pngFISH546_Cod-Time-Series-Project_Genepop_... 57KB Dec 19 2016 09:10:54 AMFISH546_Cod-Time-Series-Project_Genepop_Results_ipynb_at_master_·_nclowell_FISH546_1E084C1D.png
fish_1D8482DB.pngfish_1D8482DB.png 188KB Sep 10 2016 11:05:19 AMfish_1D8482DB.png
Fish_270_Aquatic_Ecophysiology_Syllabus_pdf__page_3_of_5__1CA07161.pngFish_270_Aquatic_Ecophysiology_Syllabus_... 43KB Mar 21 2016 11:13:57 AMFish_270_Aquatic_Ecophysiology_Syllabus_pdf__page_3_of_5__1CA07161.png
Fish_270_Aquatic_Ecophysiology_Syllabus_pdf__page_5_of_5__1CA0718C.pngFish_270_Aquatic_Ecophysiology_Syllabus_... 222KB Mar 21 2016 11:14:36 AMFish_270_Aquatic_Ecophysiology_Syllabus_pdf__page_5_of_5__1CA0718C.png
Fish_270_Aquatic_Ecophysiology_Syllabus_pdf__page_5_of_5__1CA07196.pngFish_270_Aquatic_Ecophysiology_Syllabus_... 222KB Mar 21 2016 11:14:47 AMFish_270_Aquatic_Ecophysiology_Syllabus_pdf__page_5_of_5__1CA07196.png
FISH_270_A__Aquatic_Ecophysiology_1CC5314F.pngFISH_270_A__Aquatic_Ecophysiology_1CC531... 18KB Apr 18 2016 08:14:24 AMFISH_270_A__Aquatic_Ecophysiology_1CC5314F.png
fish_release_mp4_🔊_1D8482C1.pngfish_release_mp4_🔊_1D8482C1.png 188KB Sep 10 2016 11:04:57 AMfish_release_mp4_🔊_1D8482C1.png
Flatfish_Metamorphosis_-_YouTube_1A014D84.pngFlatfish_Metamorphosis_-_YouTube_1A014D8... 219KB Oct 29 2014 09:29:58 AMFlatfish_Metamorphosis_-_YouTube_1A014D84.png
Folder_Report_-_UW-HTGC_1B387F19.pngFolder_Report_-_UW-HTGC_1B387F19.png 164KB Jun 22 2015 10:36:26 AMFolder_Report_-_UW-HTGC_1B387F19.png
Folder_Report_-_UW-HTGC_1B3880D3.pngFolder_Report_-_UW-HTGC_1B3880D3.png 64KB Jun 22 2015 10:43:47 AMFolder_Report_-_UW-HTGC_1B3880D3.png
foo_1C839257.pngfoo_1C839257.png 477KB Feb 28 2016 12:38:51 PMfoo_1C839257.png
Frontiers___Genome-wide_profiling_of_DNA_methylation_and_gene_expression_in_Crassostrea_gigas_male_gametes___Invertebrate_Physiology_1BBEF472.pngFrontiers___Genome-wide_profiling_of_DNA... 45KB Oct 02 2015 10:20:52 AMFrontiers___Genome-wide_profiling_of_DNA_methylation_and_gene_expression_in_Crassostrea_gigas_male_gametes___Invertebrate_Physiology_1BBEF472.png
Fwd__Sequencing_data_for_your_project_JG1411211_R1_-_roberts_sbr_gmail_com_-_Gmail_1A4367BF.pngFwd__Sequencing_data_for_your_project_JG... 45KB Dec 18 2014 11:51:29 AMFwd__Sequencing_data_for_your_project_JG1411211_R1_-_roberts_sbr_gmail_com_-_Gmail_1A4367BF.png
Galaxy_1A8BC049.pngGalaxy_1A8BC049.png 248KB Feb 11 2015 08:52:26 AMGalaxy_1A8BC049.png
Galaxy_1DA44C5F.pngGalaxy_1DA44C5F.png 131KB Oct 04 2016 01:45:25 PMGalaxy_1DA44C5F.png
Galaxy_17A6E2D5.pngGalaxy_17A6E2D5.png 33KB Jul 29 2013 10:56:40 AMGalaxy_17A6E2D5.png
Galaxy_17A28D59.pngGalaxy_17A28D59.png 11KB Jul 26 2013 04:02:44 AMGalaxy_17A28D59.png
Galaxy_17A684A3.pngGalaxy_17A684A3.png 15KB Jul 29 2013 04:14:44 AMGalaxy_17A684A3.png
Galaxy_17AAF7AC.pngGalaxy_17AAF7AC.png 105KB Aug 01 2013 01:14:53 PMGalaxy_17AAF7AC.png
Galaxy_17AAF717.pngGalaxy_17AAF717.png 76KB Aug 01 2013 01:12:21 PMGalaxy_17AAF717.png
Galaxy_17AAFB84.pngGalaxy_17AAFB84.png 30KB Aug 01 2013 01:31:17 PMGalaxy_17AAFB84.png
Galaxy_17ABC793.pngGalaxy_17ABC793.png 24KB Aug 02 2013 04:01:59 AMGalaxy_17ABC793.png
Galaxy_17ABC847.pngGalaxy_17ABC847.png 51KB Aug 02 2013 04:04:54 AMGalaxy_17ABC847.png
Galaxy_17AFDD6C.pngGalaxy_17AFDD6C.png 73KB Aug 05 2013 06:24:23 AMGalaxy_17AFDD6C.png
Galaxy_17B3FB13.pngGalaxy_17B3FB13.png 34KB Aug 08 2013 09:20:08 AMGalaxy_17B3FB13.png
Galaxy_17B40900.pngGalaxy_17B40900.png 40KB Aug 08 2013 10:19:39 AMGalaxy_17B40900.png
Galaxy_17C94754.pngGalaxy_17C94754.png 25KB Aug 24 2013 01:03:55 PMGalaxy_17C94754.png
Galaxy_17CA59B4.pngGalaxy_17CA59B4.png 27KB Aug 25 2013 08:34:38 AMGalaxy_17CA59B4.png
Galaxy_19A3FF18.pngGalaxy_19A3FF18.png 30KB Aug 19 2014 02:54:34 PMGalaxy_19A3FF18.png
Galaxy_187DF32D.pngGalaxy_187DF32D.png 226KB Jan 08 2014 12:57:18 PMGalaxy_187DF32D.png
Galaxy_198305B5.pngGalaxy_198305B5.png 36KB Jul 25 2014 02:37:58 PMGalaxy_198305B5.png
Galaxy_1983020F.pngGalaxy_1983020F.png 101KB Jul 25 2014 02:22:24 PMGalaxy_1983020F.png
Galaxy___RepeatExplorer_188EA49F.pngGalaxy___RepeatExplorer_188EA49F.png 328KB Jan 21 2014 04:51:50 AMGalaxy___RepeatExplorer_188EA49F.png
ga_182D258C.pngga_182D258C.png 241KB Nov 08 2013 05:58:42 AMga_182D258C.png
ga_182E7EED.pngga_182E7EED.png 241KB Nov 09 2013 06:32:26 AMga_182E7EED.png
genefish.wikispaces.com_file_view_ncb0908-1015.pdf_17F5EAF7.pnggenefish.wikispaces.com_file_view_ncb090... 198KB Sep 27 2013 09:34:01 AMgenefish.wikispaces.com_file_view_ncb0908-1015.pdf_17F5EAF7.png
genefish_-_441_Lab2_2014_19DC4525.pnggenefish_-_441_Lab2_2014_19DC4525.png 1KB Oct 01 2014 07:20:22 AMgenefish_-_441_Lab2_2014_19DC4525.png
genefish_-_441_Lab3_2014_19E9884E.pnggenefish_-_441_Lab3_2014_19E9884E.png 15KB Oct 11 2014 08:46:22 AMgenefish_-_441_Lab3_2014_19E9884E.png
genefish_-_Dave_s_Notebook_1A5F17AA.pnggenefish_-_Dave_s_Notebook_1A5F17AA.png 126KB Jan 08 2015 11:53:15 AMgenefish_-_Dave_s_Notebook_1A5F17AA.png
genefish_-_Emma_s_Brest_Lab_Notebook_1867A29B.pnggenefish_-_Emma_s_Brest_Lab_Notebook_186... 56KB Dec 22 2013 02:43:37 PMgenefish_-_Emma_s_Brest_Lab_Notebook_1867A29B.png
genefish_-_Emma_s_Brest_Lab_Notebook_1867A345.pnggenefish_-_Emma_s_Brest_Lab_Notebook_186... 56KB Dec 22 2013 02:46:27 PMgenefish_-_Emma_s_Brest_Lab_Notebook_1867A345.png
genefish_-_Emma_s_Notebook_1828F551.pnggenefish_-_Emma_s_Notebook_1828F551.png 51KB Nov 05 2013 01:43:48 AMgenefish_-_Emma_s_Notebook_1828F551.png
genefish_-_FISH441_19DC482F.pnggenefish_-_FISH441_19DC482F.png 247KB Oct 01 2014 07:33:22 AMgenefish_-_FISH441_19DC482F.png
genefish_-_FISH441_19DC495D.pnggenefish_-_FISH441_19DC495D.png 247KB Oct 01 2014 07:38:23 AMgenefish_-_FISH441_19DC495D.png
genefish_-_FISH441_19E5D6BB.pnggenefish_-_FISH441_19E5D6BB.png 127KB Oct 08 2014 01:31:56 PMgenefish_-_FISH441_19E5D6BB.png
genefish_-_home_19E8607F.pnggenefish_-_home_19E8607F.png 227KB Oct 10 2014 11:44:16 AMgenefish_-_home_19E8607F.png
genefish_-_home_19EAD656.pnggenefish_-_home_19EAD656.png 243KB Oct 12 2014 08:31:35 AMgenefish_-_home_19EAD656.png
genefish_-_home_1993F632.pnggenefish_-_home_1993F632.png 55KB Aug 07 2014 11:00:19 AMgenefish_-_home_1993F632.png
genefish_-_nb_19E832BD.pnggenefish_-_nb_19E832BD.png 20KB Oct 10 2014 08:29:02 AMgenefish_-_nb_19E832BD.png
genefish_-_nb_19E837D7.pnggenefish_-_nb_19E837D7.png 23KB Oct 10 2014 08:50:48 AMgenefish_-_nb_19E837D7.png
genefish_-_nb_19E838B0.pnggenefish_-_nb_19E838B0.png 20KB Oct 10 2014 08:54:24 AMgenefish_-_nb_19E838B0.png
genefish_-_nb_19E838F8.pnggenefish_-_nb_19E838F8.png 22KB Oct 10 2014 08:55:37 AMgenefish_-_nb_19E838F8.png
genefish_-_nb_19E8333F.pnggenefish_-_nb_19E8333F.png 23KB Oct 10 2014 08:31:12 AMgenefish_-_nb_19E8333F.png
genefish_-_nb_19E8342C.pnggenefish_-_nb_19E8342C.png 27KB Oct 10 2014 08:35:10 AMgenefish_-_nb_19E8342C.png
genefish_-_nb_19E8394A.pnggenefish_-_nb_19E8394A.png 19KB Oct 10 2014 08:56:59 AMgenefish_-_nb_19E8394A.png
genefish_-_nb_19E83859.pnggenefish_-_nb_19E83859.png 35KB Oct 10 2014 08:52:58 AMgenefish_-_nb_19E83859.png
genefish_1A7D6AE3.pnggenefish_1A7D6AE3.png 92KB Jan 31 2015 11:56:19 AMgenefish_1A7D6AE3.png
genefish_1DBACDCF.pnggenefish_1DBACDCF.png 345KB Oct 21 2016 03:27:34 PMgenefish_1DBACDCF.png
genefish_1DC39FD3.pnggenefish_1DC39FD3.png 460KB Oct 28 2016 08:01:41 AMgenefish_1DC39FD3.png
genefish_1DC56C79.pnggenefish_1DC56C79.png 381KB Oct 29 2016 04:47:07 PMgenefish_1DC56C79.png
genefish_1DC572E1.pnggenefish_1DC572E1.png 245KB Oct 29 2016 05:14:27 PMgenefish_1DC572E1.png
genefish_1DC25991.pnggenefish_1DC25991.png 178KB Oct 27 2016 08:49:38 AMgenefish_1DC25991.png
genefish_1DC57645.pnggenefish_1DC57645.png 365KB Oct 29 2016 05:28:55 PMgenefish_1DC57645.png
genefish_1DCECD8D.pnggenefish_1DCECD8D.png 352KB Nov 05 2016 07:31:43 PMgenefish_1DCECD8D.png
genefish_1DE8C255.pnggenefish_1DE8C255.png 472KB Nov 25 2016 11:02:49 AMgenefish_1DE8C255.png
genefish_1DEB3745.pnggenefish_1DEB3745.png 242KB Nov 27 2016 07:46:17 AMgenefish_1DEB3745.png
genefish_1832A007.pnggenefish_1832A007.png 93KB Nov 12 2013 09:42:42 AMgenefish_1832A007.png
genefish_18329D53.pnggenefish_18329D53.png 320KB Nov 12 2013 09:31:16 AMgenefish_18329D53.png
genefish_18329E6A.pnggenefish_18329E6A.png 311KB Nov 12 2013 09:35:56 AMgenefish_18329E6A.png
genefish_18329E98.pnggenefish_18329E98.png 311KB Nov 12 2013 09:36:42 AMgenefish_18329E98.png
Generate_Plot_showing_CpG_o_e_and_GO_slim_for_Geoduck_transcriptome_·_Issue__377_·_sr320_LabDocs_1E01BB53.pngGenerate_Plot_showing_CpG_o_e_and_GO_sli... 70KB Dec 14 2016 09:39:33 AMGenerate_Plot_showing_CpG_o_e_and_GO_slim_for_Geoduck_transcriptome_·_Issue__377_·_sr320_LabDocs_1E01BB53.png
Gene_expression_analysis_of_Pacific_oysters__Crassostrea_gigas__subjected_to_accute_heat_stress_1ABCC885.pngGene_expression_analysis_of_Pacific_oyst... 186KB Mar 20 2015 02:28:36 PMGene_expression_analysis_of_Pacific_oysters__Crassostrea_gigas__subjected_to_accute_heat_stress_1ABCC885.png
genome_182D2504.pnggenome_182D2504.png 241KB Nov 08 2013 05:56:26 AMgenome_182D2504.png
Genomics_Core_Facility_-_Show_Sample_2035_1A33EB3B.pngGenomics_Core_Facility_-_Show_Sample_203... 37KB Dec 06 2014 05:56:18 PMGenomics_Core_Facility_-_Show_Sample_2035_1A33EB3B.png
Genomics_Core_Facility_-_Show_Sample_2035_1A33EB4D.pngGenomics_Core_Facility_-_Show_Sample_203... 37KB Dec 06 2014 05:56:37 PMGenomics_Core_Facility_-_Show_Sample_2035_1A33EB4D.png
Genotype_by_sequencing_November_2015_·_RobertsLab_project-olympia_oyster-genomic_Wiki_🔊_1CEB70ED.pngGenotype_by_sequencing_November_2015_·_... 87KB May 17 2016 08:32:02 AMGenotype_by_sequencing_November_2015_·_RobertsLab_project-olympia_oyster-genomic_Wiki_🔊_1CEB70ED.png
Geo-v3-join-uniprot-all0916-condensed_tab_1D95A0E9.pngGeo-v3-join-uniprot-all0916-condensed_ta... 246KB Sep 23 2016 10:42:04 AMGeo-v3-join-uniprot-all0916-condensed_tab_1D95A0E9.png
Geoduck-transcriptome_v3_bigtablefinal_1DD8D7B8.pngGeoduck-transcriptome_v3_bigtablefinal_1... 137KB Nov 13 2016 09:17:47 AMGeoduck-transcriptome_v3_bigtablefinal_1DD8D7B8.png
Geoduck-transcriptome_v3_bigtable_1DC0E1C7.pngGeoduck-transcriptome_v3_bigtable_1DC0E1... 78KB Oct 26 2016 06:06:16 AMGeoduck-transcriptome_v3_bigtable_1DC0E1C7.png
Geoduck-transcriptome_v3_bigtable_1DC0E157.pngGeoduck-transcriptome_v3_bigtable_1DC0E1... 134KB Oct 26 2016 06:04:26 AMGeoduck-transcriptome_v3_bigtable_1DC0E157.png
Geoduck-transcriptome_v3_smalltablefinal_1DD3ABBE.pngGeoduck-transcriptome_v3_smalltablefinal... 428KB Nov 09 2016 11:08:49 AMGeoduck-transcriptome_v3_smalltablefinal_1DD3ABBE.png
Geoduck_10_Day_DMR_annotations_–_quarter-shell_–_Staging_for_my_Lab_Notebook_1E4A405A.pngGeoduck_10_Day_DMR_annotations_–_quart... 62KB Feb 07 2017 09:50:20 AMGeoduck_10_Day_DMR_annotations_–_quarter-shell_–_Staging_for_my_Lab_Notebook_1E4A405A.png
Geoduck_Protein_Expression_-_Google_Docs_1DC24BDF.pngGeoduck_Protein_Expression_-_Google_Docs... 214KB Oct 27 2016 07:51:12 AMGeoduck_Protein_Expression_-_Google_Docs_1DC24BDF.png
Geoduck_SeqIndividuals_StageInfo_xlsx_1BF26834.pngGeoduck_SeqIndividuals_StageInfo_xlsx_1B... 60KB Nov 10 2015 10:00:22 AMGeoduck_SeqIndividuals_StageInfo_xlsx_1BF26834.png
Geoduck_—_oystergen_es_1DA192F0.pngGeoduck_—_oystergen_es_1DA192F0.png 390KB Oct 02 2016 12:09:39 PMGeoduck_—_oystergen_es_1DA192F0.png
GEO_Accession_viewer_1AFD0D64.pngGEO_Accession_viewer_1AFD0D64.png 299KB May 08 2015 08:27:33 AMGEO_Accession_viewer_1AFD0D64.png
GEO_Accession_viewer_1AFD0D68.pngGEO_Accession_viewer_1AFD0D68.png 299KB May 08 2015 08:27:37 AMGEO_Accession_viewer_1AFD0D68.png
GEO_Accession_viewer_1B010440.pngGEO_Accession_viewer_1B010440.png 299KB May 11 2015 08:37:36 AMGEO_Accession_viewer_1B010440.png
Germline_DNA_methylation_in_five_coral_transcriptomes_1ABCC84E.pngGermline_DNA_methylation_in_five_coral_t... 124KB Mar 20 2015 02:27:42 PMGermline_DNA_methylation_in_five_coral_transcriptomes_1ABCC84E.png
GitHub_1BB9B5FB.pngGitHub_1BB9B5FB.png 37KB Sep 28 2015 10:53:01 AMGitHub_1BB9B5FB.png
GitHub_1BB9B6E5.pngGitHub_1BB9B6E5.png 32KB Sep 28 2015 10:56:54 AMGitHub_1BB9B6E5.png
GitHub_1BB9B82B.pngGitHub_1BB9B82B.png 30KB Sep 28 2015 11:02:20 AMGitHub_1BB9B82B.png
GitHub_Desktop_-_Google_Chrome_1BB99FED.pngGitHub_Desktop_-_Google_Chrome_1BB99FED.png 186KB Sep 28 2015 09:18:53 AMGitHub_Desktop_-_Google_Chrome_1BB99FED.png
Git_2_5_3_Setup_1BB99E76.pngGit_2_5_3_Setup_1BB99E76.png 67KB Sep 28 2015 09:12:39 AMGit_2_5_3_Setup_1BB99E76.png
Git_for_Windows_-_Windows_Internet_Explorer_1BB99C85.pngGit_for_Windows_-_Windows_Internet_Explo... 83KB Sep 28 2015 09:04:22 AMGit_for_Windows_-_Windows_Internet_Explorer_1BB99C85.png
Git_Gui_1BB99F93.pngGit_Gui_1BB99F93.png 25KB Sep 28 2015 09:17:24 AMGit_Gui_1BB99F93.png
Git_Gui_1BB99F97.pngGit_Gui_1BB99F97.png 25KB Sep 28 2015 09:17:27 AMGit_Gui_1BB99F97.png
GonadMethylation_WorkingMS_-_Google_Drive_17A87506.pngGonadMethylation_WorkingMS_-_Google_Driv... 78KB Jul 30 2013 03:32:48 PMGonadMethylation_WorkingMS_-_Google_Drive_17A87506.png
GonadMethylation_WorkingMS_-_Google_Drive_1805A072.pngGonadMethylation_WorkingMS_-_Google_Driv... 61KB Oct 09 2013 07:32:18 AMGonadMethylation_WorkingMS_-_Google_Drive_1805A072.png
GO_Slims_and_GO_Term_Comparison_1D8B5AA3.pngGO_Slims_and_GO_Term_Comparison_1D8B5AA3... 302KB Sep 15 2016 03:39:33 PMGO_Slims_and_GO_Term_Comparison_1D8B5AA3.png
Grace_Crandall_-_Google__19E82C72.pngGrace_Crandall_-_Google__19E82C72.png 82KB Oct 10 2014 08:02:11 AMGrace_Crandall_-_Google__19E82C72.png
GradePage_FISH_495_A_1BBC53BD.pngGradePage_FISH_495_A_1BBC53BD.png 54KB Sep 30 2015 10:30:39 AMGradePage_FISH_495_A_1BBC53BD.png
Graduate_Applicants_2014_-_SAFS_-_Prospective_Student_Days_an____1896BB92.pngGraduate_Applicants_2014_-_SAFS_-_Prospe... 23KB Jan 27 2014 08:08:14 AMGraduate_Applicants_2014_-_SAFS_-_Prospective_Student_Days_an____1896BB92.png
greenbird_1A7C3E50.pnggreenbird_1A7C3E50.png 19KB Jan 30 2015 02:33:53 PMgreenbird_1A7C3E50.png
greenbird_1A8137E5.pnggreenbird_1A8137E5.png 244KB Feb 03 2015 09:07:50 AMgreenbird_1A8137E5.png
greenbird_1AADD9D0.pnggreenbird_1AADD9D0.png 137KB Mar 09 2015 06:38:25 AMgreenbird_1AADD9D0.png
greenbird_1AADDA02.pnggreenbird_1AADDA02.png 140KB Mar 09 2015 06:39:15 AMgreenbird_1AADDA02.png
greenbird_17A05407.pnggreenbird_17A05407.png 59KB Jul 24 2013 11:33:36 AMgreenbird_17A05407.png
greenbird_18AA510D.pnggreenbird_18AA510D.png 100KB Feb 11 2014 04:37:34 AMgreenbird_18AA510D.png
greenbird_19A511DE.pnggreenbird_19A511DE.png 32KB Aug 20 2014 10:26:56 AMgreenbird_19A511DE.png
greenbird_19A51201.pnggreenbird_19A51201.png 12KB Aug 20 2014 10:27:29 AMgreenbird_19A51201.png
greenbird_19C0EA14.pnggreenbird_19C0EA14.png 24KB Sep 10 2014 01:20:37 PMgreenbird_19C0EA14.png
greenbird_189AB0DA.pnggreenbird_189AB0DA.png 89KB Jan 30 2014 08:11:44 AMgreenbird_189AB0DA.png
greenbird_195C8E4C.pnggreenbird_195C8E4C.png 81KB Jun 26 2014 10:22:21 AMgreenbird_195C8E4C.png
greenbird_196B0D35.pnggreenbird_196B0D35.png 79KB Jul 07 2014 10:15:34 AMgreenbird_196B0D35.png
greenbird_197DC8B3.pnggreenbird_197DC8B3.png 60KB Jul 21 2014 03:17:53 PMgreenbird_197DC8B3.png
greenbird_197DC82A.pnggreenbird_197DC82A.png 12KB Jul 21 2014 03:15:37 PMgreenbird_197DC82A.png
greenbird_198C252E.pnggreenbird_198C252E.png 80KB Aug 01 2014 12:42:39 PMgreenbird_198C252E.png
greenbird_19226E44.pnggreenbird_19226E44.png 26KB May 13 2014 08:14:13 AMgreenbird_19226E44.png
greenbird_19772A25.pnggreenbird_19772A25.png 106KB Jul 16 2014 02:46:13 PMgreenbird_19772A25.png
greenbird_1977290F.pnggreenbird_1977290F.png 37KB Jul 16 2014 02:41:36 PMgreenbird_1977290F.png
greenbird_1978345A.pnggreenbird_1978345A.png 77KB Jul 17 2014 09:42:04 AMgreenbird_1978345A.png
greenbird_19772955.pnggreenbird_19772955.png 29KB Jul 16 2014 02:42:45 PMgreenbird_19772955.png
Green_Laboratory_Certificate_to_Roberts_Lab__pdf_pdf_19C36529.pngGreen_Laboratory_Certificate_to_Roberts_... 191KB Sep 12 2014 10:30:19 AMGreen_Laboratory_Certificate_to_Roberts_Lab__pdf_pdf_19C36529.png
Green_Laboratory_Letter_to_Roberts_Lab_pdf_19C365D5.pngGreen_Laboratory_Letter_to_Roberts_Lab_p... 184KB Sep 12 2014 10:33:11 AMGreen_Laboratory_Letter_to_Roberts_Lab_pdf_19C365D5.png
half-shell___Lab_notebook_of_Steven_Roberts_1ACECD0B.pnghalf-shell___Lab_notebook_of_Steven_Robe... 16KB Apr 03 2015 06:28:44 AMhalf-shell___Lab_notebook_of_Steven_Roberts_1ACECD0B.png
half-shell___Lab_notebook_of_Steven_Roberts_1ACECD10.pnghalf-shell___Lab_notebook_of_Steven_Robe... 16KB Apr 03 2015 06:28:48 AMhalf-shell___Lab_notebook_of_Steven_Roberts_1ACECD10.png
Haliotis_crac_CCCEcombined_fastq_FastQC_Report_1A818730.pngHaliotis_crac_CCCEcombined_fastq_FastQC_... 45KB Feb 03 2015 02:46:08 PMHaliotis_crac_CCCEcombined_fastq_FastQC_Report_1A818730.png
Hangouts_and_DAVID__Database_for_Annotation__Visualization__and_Integrated_Discovery__Laboratory_of_Immunopathogenesis_and_Bioinformatics__LIB___National_Institute_of_Allergies_and_Infectious_Diseases__NIAID___Science_Applications_Internati_17CD145D.Hangouts_and_DAVID__Database_for_Annotat... 444KB Aug 27 2013 10:15:42 AM
Hazel_1A90E660.pngHazel_1A90E660.png 101KB Feb 15 2015 06:36:18 AMHazel_1A90E660.png
HeatDMR_1B4C7BD4.pngHeatDMR_1B4C7BD4.png 87KB Jul 07 2015 02:27:41 PMHeatDMR_1B4C7BD4.png
Help_19957CAF.pngHelp_19957CAF.png 375KB Aug 08 2014 02:46:24 PMHelp_19957CAF.png
HOBOware_Preferences_and_HOBOware_Pro_18F6C0D1.pngHOBOware_Preferences_and_HOBOware_Pro_18... 77KB Apr 10 2014 05:06:41 AMHOBOware_Preferences_and_HOBOware_Pro_18F6C0D1.png
HOBO_Pendant®_Temperature_Alarm_Data_Logger_64K_1D1088F1.pngHOBO_Pendant®_Temperature_Alarm_Data_Lo... 23KB Jun 14 2016 11:48:20 AMHOBO_Pendant®_Temperature_Alarm_Data_Logger_64K_1D1088F1.png
Home_1A41E21F.pngHome_1A41E21F.png 23KB Dec 17 2014 08:09:04 AMHome_1A41E21F.png
Home___Integrative_Genomics_Viewer_1DDA9867.pngHome___Integrative_Genomics_Viewer_1DDA9... 92KB Nov 14 2016 05:12:10 PMHome___Integrative_Genomics_Viewer_1DDA9867.png
Home_·_sr320_austral_Wiki_1A716044.pngHome_·_sr320_austral_Wiki_1A716044.png 122KB Jan 22 2015 08:43:56 AMHome_·_sr320_austral_Wiki_1A716044.png
Home_·_sr320_course-fish546-2016_Wiki_1D9C6972.pngHome_·_sr320_course-fish546-2016_Wiki_1... 89KB Sep 28 2016 02:11:18 PMHome_·_sr320_course-fish546-2016_Wiki_1D9C6972.png
Home_·_sr320_course-fish546-2016_Wiki_1D9DA7CA.pngHome_·_sr320_course-fish546-2016_Wiki_1... 76KB Sep 29 2016 12:49:31 PMHome_·_sr320_course-fish546-2016_Wiki_1D9DA7CA.png
Home_·_sr320_course-fish546-2016_Wiki_1DABE2F4.pngHome_·_sr320_course-fish546-2016_Wiki_1... 76KB Oct 10 2016 07:53:44 AMHome_·_sr320_course-fish546-2016_Wiki_1DABE2F4.png
Home_·_trinityrnaseq_trinityrnaseq_Wiki_1BDC352D.pngHome_·_trinityrnaseq_trinityrnaseq_Wiki... 130KB Oct 24 2015 02:52:46 PMHome_·_trinityrnaseq_trinityrnaseq_Wiki_1BDC352D.png
Home_·_trinityrnaseq_trinityrnaseq_Wiki_1DBE50A5.pngHome_·_trinityrnaseq_trinityrnaseq_Wiki... 226KB Oct 24 2016 07:22:33 AMHome_·_trinityrnaseq_trinityrnaseq_Wiki_1DBE50A5.png
https__main.g2.bx.psu.edu_workflow_gen_image_id_def91d78ab0220d9_and_Directory_Listing_of__cnidarian_17A868E0.pnghttps__main.g2.bx.psu.edu_workflow_gen_i... 29KB Jul 30 2013 02:40:56 PMhttps__main.g2.bx.psu.edu_workflow_gen_image_id_def91d78ab0220d9_and_Directory_Listing_of__cnidarian_17A868E0.png
https___dl_dropboxusercontent_com_u_115356_austral_01_Introduction_f_pdf_1A6EF2DE.pnghttps___dl_dropboxusercontent_com_u_1153... 1538KB Jan 20 2015 12:32:57 PMhttps___dl_dropboxusercontent_com_u_115356_austral_01_Introduction_f_pdf_1A6EF2DE.png
https___peerj_com_preprints_704v1_pdf_1ACB5AEF.pnghttps___peerj_com_preprints_704v1_pdf_1A... 213KB Mar 31 2015 03:45:04 PMhttps___peerj_com_preprints_704v1_pdf_1ACB5AEF.png
https___peerj_com_preprints_704v1_pdf_1ACB5B0E.pnghttps___peerj_com_preprints_704v1_pdf_1A... 233KB Mar 31 2015 03:45:34 PMhttps___peerj_com_preprints_704v1_pdf_1ACB5B0E.png
https___peerj_com_preprints_704v1_pdf_1ACB5B29.pnghttps___peerj_com_preprints_704v1_pdf_1A... 205KB Mar 31 2015 03:46:02 PMhttps___peerj_com_preprints_704v1_pdf_1ACB5B29.png
https___peerj_com_preprints_704v1_pdf_1ACB59E4.pnghttps___peerj_com_preprints_704v1_pdf_1A... 198KB Mar 31 2015 03:40:37 PMhttps___peerj_com_preprints_704v1_pdf_1ACB59E4.png
https___peerj_com_preprints_704_pdf_1AD06E8F.pnghttps___peerj_com_preprints_704_pdf_1AD0... 114KB Apr 04 2015 12:10:08 PMhttps___peerj_com_preprints_704_pdf_1AD06E8F.png
https___peerj_com_preprints_704_pdf_1AD07173.pnghttps___peerj_com_preprints_704_pdf_1AD0... 121KB Apr 04 2015 12:22:28 PMhttps___peerj_com_preprints_704_pdf_1AD07173.png
https___peerj_com_preprints_704_pdf_1AD0722F.pnghttps___peerj_com_preprints_704_pdf_1AD0... 111KB Apr 04 2015 12:25:36 PMhttps___peerj_com_preprints_704_pdf_1AD0722F.png
hummingbird_1A93FC67.pnghummingbird_1A93FC67.png 675KB Feb 17 2015 02:47:05 PMhummingbird_1A93FC67.png
hummingbird_1A857DA1.pnghummingbird_1A857DA1.png 31KB Feb 06 2015 02:54:25 PMhummingbird_1A857DA1.png
hummingbird_1D89C349.pnghummingbird_1D89C349.png 17KB Sep 14 2016 10:41:36 AMhummingbird_1D89C349.png
hummingbird_1DC11E36.pnghummingbird_1DC11E36.png 573KB Oct 26 2016 10:24:09 AMhummingbird_1DC11E36.png
hummingbird_1DC39EA7.pnghummingbird_1DC39EA7.png 541KB Oct 28 2016 07:56:42 AMhummingbird_1DC39EA7.png
hummingbird_1DC2359E.pnghummingbird_1DC2359E.png 406KB Oct 27 2016 06:16:14 AMhummingbird_1DC2359E.png
Hunting_Bivalve_Larvae__A_Field_Report___Becker_Lab_1B936FF0.pngHunting_Bivalve_Larvae__A_Field_Report__... 125KB Aug 30 2015 10:08:02 AMHunting_Bivalve_Larvae__A_Field_Report___Becker_Lab_1B936FF0.png
ICSASG_v2_-_Assembly_-_NCBI_1CDBE816.pngICSASG_v2_-_Assembly_-_NCBI_1CDBE816.png 226KB May 05 2016 01:44:11 PMICSASG_v2_-_Assembly_-_NCBI_1CDBE816.png
ifremer_Roberts.key_18354FB2.pngifremer_Roberts.key_18354FB2.png 243KB Nov 14 2013 10:36:55 AMifremer_Roberts.key_18354FB2.png
ifremer_Roberts.key_1835502B.pngifremer_Roberts.key_1835502B.png 45KB Nov 14 2013 10:38:42 AMifremer_Roberts.key_1835502B.png
IGV_-_Session__http__eagle.fish.washington.edu_cnidarian_igv_session_073013.xml_17AAFAC5.pngIGV_-_Session__http__eagle.fish.washingt... 69KB Aug 01 2013 01:28:08 PMIGV_-_Session__http__eagle.fish.washington.edu_cnidarian_igv_session_073013.xml_17AAFAC5.png
IGV_-_Session__http__eagle.fish.washington.edu_cnidarian_igv_session_073013.xml_17AAFB13.pngIGV_-_Session__http__eagle.fish.washingt... 69KB Aug 01 2013 01:29:25 PMIGV_-_Session__http__eagle.fish.washington.edu_cnidarian_igv_session_073013.xml_17AAFB13.png
IGV_-_Session__http__eagle.fish.washington.edu_cnidarian_igv_session_073013.xml_17AFF782.pngIGV_-_Session__http__eagle.fish.washingt... 57KB Aug 05 2013 08:15:41 AMIGV_-_Session__http__eagle.fish.washington.edu_cnidarian_igv_session_073013.xml_17AFF782.png
IGV_-_Session__http__eagle.fish.washington.edu_cnidarian_igv_session_073013.xml_17B4011F.pngIGV_-_Session__http__eagle.fish.washingt... 105KB Aug 08 2013 09:45:59 AMIGV_-_Session__http__eagle.fish.washington.edu_cnidarian_igv_session_073013.xml_17B4011F.png
IGV_-_Session__http__eagle.fish.washington.edu_cnidarian_igv_session_073013.xml_and_sr320_—_igv.command_—_java_—_80×24_187B2E46.pngIGV_-_Session__http__eagle.fish.washingt... 56KB Jan 06 2014 10:32:39 AMIGV_-_Session__http__eagle.fish.washington.edu_cnidarian_igv_session_073013.xml_and_sr320_—_igv.command_—_java_—_80×24_187B2E46.png
IGV_-_Session__http__eagle.fish.washington.edu_cnidarian_oyster_v9_igv_session.xml_and_CC_ampk_183269B4.pngIGV_-_Session__http__eagle.fish.washingt... 58KB Nov 12 2013 05:50:48 AMIGV_-_Session__http__eagle.fish.washington.edu_cnidarian_oyster_v9_igv_session.xml_and_CC_ampk_183269B4.png
IGV_-_Session__http__eagle.fish.washington.edu_trilobite_Crassostrea_gigas_v9_tracks_BiGill_igv_charlie.xml_180F2D2E.pngIGV_-_Session__http__eagle.fish.washingt... 52KB Oct 16 2013 01:23:13 PMIGV_-_Session__http__eagle.fish.washington.edu_trilobite_Crassostrea_gigas_v9_tracks_BiGill_igv_charlie.xml_180F2D2E.png
IGV_-_Session__http__eagle.fish.washington.edu_trilobite_Crassostrea_gigas_v9_tracks_BiGill_igv_charlie.xml_18326ABC.pngIGV_-_Session__http__eagle.fish.washingt... 65KB Nov 12 2013 05:55:12 AMIGV_-_Session__http__eagle.fish.washington.edu_trilobite_Crassostrea_gigas_v9_tracks_BiGill_igv_charlie.xml_18326ABC.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A0C9.pngIGV_-_Session__http___eagle_fish_washing... 44KB Jul 03 2014 07:31:39 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A0C9.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A01E.pngIGV_-_Session__http___eagle_fish_washing... 42KB Jul 03 2014 07:28:47 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A01E.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A07D.pngIGV_-_Session__http___eagle_fish_washing... 52KB Jul 03 2014 07:30:22 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A07D.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A1B2.pngIGV_-_Session__http___eagle_fish_washing... 47KB Jul 03 2014 07:35:31 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A1B2.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A2B9.pngIGV_-_Session__http___eagle_fish_washing... 41KB Jul 03 2014 07:39:55 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A2B9.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A3F2.pngIGV_-_Session__http___eagle_fish_washing... 70KB Jul 03 2014 07:45:07 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A3F2.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A4AF.pngIGV_-_Session__http___eagle_fish_washing... 55KB Jul 03 2014 07:48:16 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A4AF.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A5A7.pngIGV_-_Session__http___eagle_fish_washing... 90KB Jul 03 2014 07:52:24 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A5A7.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A5EE.pngIGV_-_Session__http___eagle_fish_washing... 68KB Jul 03 2014 07:53:35 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A5EE.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A6A4.pngIGV_-_Session__http___eagle_fish_washing... 54KB Jul 03 2014 07:56:37 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A6A4.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A6AA.pngIGV_-_Session__http___eagle_fish_washing... 54KB Jul 03 2014 07:56:43 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A6AA.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A6F9.pngIGV_-_Session__http___eagle_fish_washing... 60KB Jul 03 2014 07:58:01 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A6F9.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A7D1.pngIGV_-_Session__http___eagle_fish_washing... 46KB Jul 03 2014 08:01:46 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A7D1.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A8C5.pngIGV_-_Session__http___eagle_fish_washing... 79KB Jul 03 2014 08:05:42 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A8C5.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A8DA.pngIGV_-_Session__http___eagle_fish_washing... 79KB Jul 03 2014 08:06:03 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A8DA.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A9F5.pngIGV_-_Session__http___eagle_fish_washing... 73KB Jul 03 2014 08:10:46 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A9F5.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A14F.pngIGV_-_Session__http___eagle_fish_washing... 72KB Jul 03 2014 07:33:52 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A14F.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A26B.pngIGV_-_Session__http___eagle_fish_washing... 62KB Jul 03 2014 07:38:37 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A26B.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A51D.pngIGV_-_Session__http___eagle_fish_washing... 59KB Jul 03 2014 07:50:06 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A51D.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A73A.pngIGV_-_Session__http___eagle_fish_washing... 47KB Jul 03 2014 07:59:07 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A73A.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A77C.pngIGV_-_Session__http___eagle_fish_washing... 87KB Jul 03 2014 08:00:13 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A77C.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A90C.pngIGV_-_Session__http___eagle_fish_washing... 53KB Jul 03 2014 08:06:53 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A90C.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A98B.pngIGV_-_Session__http___eagle_fish_washing... 73KB Jul 03 2014 08:09:00 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A98B.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A218.pngIGV_-_Session__http___eagle_fish_washing... 47KB Jul 03 2014 07:37:13 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A218.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A345.pngIGV_-_Session__http___eagle_fish_washing... 48KB Jul 03 2014 07:42:15 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A345.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A391.pngIGV_-_Session__http___eagle_fish_washing... 77KB Jul 03 2014 07:43:30 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A391.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A838.pngIGV_-_Session__http___eagle_fish_washing... 64KB Jul 03 2014 08:03:21 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A838.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A878.pngIGV_-_Session__http___eagle_fish_washing... 37KB Jul 03 2014 08:04:26 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A878.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A922.pngIGV_-_Session__http___eagle_fish_washing... 73KB Jul 03 2014 08:07:15 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965A922.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AA9F.pngIGV_-_Session__http___eagle_fish_washing... 134KB Jul 03 2014 08:13:36 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AA9F.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AB7F.pngIGV_-_Session__http___eagle_fish_washing... 66KB Jul 03 2014 08:17:20 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AB7F.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AB13.pngIGV_-_Session__http___eagle_fish_washing... 56KB Jul 03 2014 08:15:32 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AB13.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965ABB3.pngIGV_-_Session__http___eagle_fish_washing... 74KB Jul 03 2014 08:18:12 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965ABB3.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AC6E.pngIGV_-_Session__http___eagle_fish_washing... 50KB Jul 03 2014 08:21:19 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AC6E.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965ACD4.pngIGV_-_Session__http___eagle_fish_washing... 71KB Jul 03 2014 08:23:00 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965ACD4.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AD3E.pngIGV_-_Session__http___eagle_fish_washing... 93KB Jul 03 2014 08:24:48 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AD3E.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AD9B.pngIGV_-_Session__http___eagle_fish_washing... 76KB Jul 03 2014 08:26:20 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AD9B.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AD69.pngIGV_-_Session__http___eagle_fish_washing... 97KB Jul 03 2014 08:25:30 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AD69.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AE5E.pngIGV_-_Session__http___eagle_fish_washing... 73KB Jul 03 2014 08:29:35 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AE5E.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AE20.pngIGV_-_Session__http___eagle_fish_washing... 52KB Jul 03 2014 08:28:33 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AE20.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AEB8.pngIGV_-_Session__http___eagle_fish_washing... 67KB Jul 03 2014 08:31:05 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AEB8.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AEF4.pngIGV_-_Session__http___eagle_fish_washing... 56KB Jul 03 2014 08:32:05 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AEF4.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AF4E.pngIGV_-_Session__http___eagle_fish_washing... 80KB Jul 03 2014 08:33:34 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AF4E.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AFA6.pngIGV_-_Session__http___eagle_fish_washing... 41KB Jul 03 2014 08:35:03 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_1965AFA6.png
IGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_and_Inbox__1__-_roberts_sbr_gmail_com_-_Gmail_1965A43C.pngIGV_-_Session__http___eagle_fish_washing... 70KB Jul 03 2014 07:46:21 AMIGV_-_Session__http___eagle_fish_washington_edu_cnidarian_HS_array_igv_session2_xml_and_Inbox__1__-_roberts_sbr_gmail_com_-_Gmail_1965A43C.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_bu-alanine-wd_17-03-16c_Cvirg_igv_session_xml_and_methyl-igv_awk_1E7C8597.pngIGV_-_Session__http___owl_fish_washingto... 35KB Mar 17 2017 01:59:06 PMIGV_-_Session__http___owl_fish_washington_edu_halfshell_bu-alanine-wd_17-03-16c_Cvirg_igv_session_xml_and_methyl-igv_awk_1E7C8597.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E1ABC91.pngIGV_-_Session__http___owl_fish_washingto... 28KB Jan 02 2017 08:51:32 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E1ABC91.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E1ABDB7.pngIGV_-_Session__http___owl_fish_washingto... 19KB Jan 02 2017 08:56:24 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E1ABDB7.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E1ABE46.pngIGV_-_Session__http___owl_fish_washingto... 41KB Jan 02 2017 08:58:47 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E1ABE46.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A2F48.pngIGV_-_Session__http___owl_fish_washingto... 26KB Feb 07 2017 08:37:30 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A2F48.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A2FE0.pngIGV_-_Session__http___owl_fish_washingto... 28KB Feb 07 2017 08:40:01 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A2FE0.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A30DB.pngIGV_-_Session__http___owl_fish_washingto... 36KB Feb 07 2017 08:44:11 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A30DB.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A31C1.pngIGV_-_Session__http___owl_fish_washingto... 34KB Feb 07 2017 08:48:03 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A31C1.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A32DB.pngIGV_-_Session__http___owl_fish_washingto... 27KB Feb 07 2017 08:52:44 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A32DB.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A320F.pngIGV_-_Session__http___owl_fish_washingto... 64KB Feb 07 2017 08:49:20 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A320F.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A328F.pngIGV_-_Session__http___owl_fish_washingto... 51KB Feb 07 2017 08:51:28 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A328F.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A332B.pngIGV_-_Session__http___owl_fish_washingto... 66KB Feb 07 2017 08:54:04 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A332B.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A3028.pngIGV_-_Session__http___owl_fish_washingto... 26KB Feb 07 2017 08:41:13 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A3028.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A3092.pngIGV_-_Session__http___owl_fish_washingto... 24KB Feb 07 2017 08:42:59 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A3092.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A3145.pngIGV_-_Session__http___owl_fish_washingto... 76KB Feb 07 2017 08:45:58 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A3145.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A3183.pngIGV_-_Session__http___owl_fish_washingto... 66KB Feb 07 2017 08:46:59 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4A3183.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E44CACE.pngIGV_-_Session__http___owl_fish_washingto... 89KB Feb 03 2017 06:27:28 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E44CACE.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E44D26D.pngIGV_-_Session__http___owl_fish_washingto... 89KB Feb 03 2017 06:59:57 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E44D26D.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E44D200.pngIGV_-_Session__http___owl_fish_washingto... 89KB Feb 03 2017 06:58:10 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E44D200.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E452A9A.pngIGV_-_Session__http___owl_fish_washingto... 23KB Feb 03 2017 01:16:13 PMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E452A9A.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E452C1E.pngIGV_-_Session__http___owl_fish_washingto... 34KB Feb 03 2017 01:22:39 PMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E452C1E.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E452CB8.pngIGV_-_Session__http___owl_fish_washingto... 33KB Feb 03 2017 01:25:13 PMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E452CB8.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E452D1C.pngIGV_-_Session__http___owl_fish_washingto... 68KB Feb 03 2017 01:26:53 PMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E452D1C.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E493D9B.pngIGV_-_Session__http___owl_fish_washingto... 34KB Feb 06 2017 03:26:20 PMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E493D9B.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4004A0.pngIGV_-_Session__http___owl_fish_washingto... 48KB Jan 30 2017 03:32:50 PMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_1E4004A0.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_1E1ABEF5.pngIGV_-_Session__http___owl_fish_washingto... 34KB Jan 02 2017 09:01:43 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_1E1ABEF5.png
IGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_and_igv_session-EPI-010217_xml_1E1ABE82.pngIGV_-_Session__http___owl_fish_washingto... 31KB Jan 02 2017 08:59:47 AMIGV_-_Session__http___owl_fish_washington_edu_halfshell_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_and_igv_session-EPI-010217_xml_1E1ABE82.png
IGV_-_Session__http___owl_fish_washington_edu_scaphapoda_Sean_IGVstuff_igv_session_xml_and_Redirecting_and_sr320_—_java_—_80×24_1E3252E6.pngIGV_-_Session__http___owl_fish_washingto... 433KB Jan 20 2017 06:15:04 AMIGV_-_Session__http___owl_fish_washington_edu_scaphapoda_Sean_IGVstuff_igv_session_xml_and_Redirecting_and_sr320_—_java_—_80×24_1E3252E6.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_1E1AC2FE.pngIGV_-_Session___Users_sr320_data-genomic... 39KB Jan 02 2017 09:18:55 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_1E1AC2FE.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_1E1AC1B6.pngIGV_-_Session___Users_sr320_data-genomic... 34KB Jan 02 2017 09:13:27 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_1E1AC1B6.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_1E1AC4CA.pngIGV_-_Session___Users_sr320_data-genomic... 32KB Jan 02 2017 09:26:35 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_1E1AC4CA.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_1E1AC16D.pngIGV_-_Session___Users_sr320_data-genomic... 42KB Jan 02 2017 09:12:15 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_1E1AC16D.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_and_sr320_—_java_—_80×24_1E1AC287.pngIGV_-_Session___Users_sr320_data-genomic... 54KB Jan 02 2017 09:16:56 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_and_sr320_—_java_—_80×24_1E1AC287.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_and_sr320_—_java_—_80×24_1E1AC330.pngIGV_-_Session___Users_sr320_data-genomic... 39KB Jan 02 2017 09:19:45 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_and_sr320_—_java_—_80×24_1E1AC330.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_and_sr320_—_java_—_80×24_1E1AC525.pngIGV_-_Session___Users_sr320_data-genomic... 40KB Jan 02 2017 09:28:06 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_Google_Calendar_-_Week_of_Jan_1__2017_and_sr320_—_java_—_80×24_1E1AC525.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_1E1AC3D3.pngIGV_-_Session___Users_sr320_data-genomic... 46KB Jan 02 2017 09:22:28 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_1E1AC3D3.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_1E1AC4FF.pngIGV_-_Session___Users_sr320_data-genomic... 49KB Jan 02 2017 09:27:28 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_1E1AC4FF.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_1E1AC20B.pngIGV_-_Session___Users_sr320_data-genomic... 49KB Jan 02 2017 09:14:52 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_1E1AC20B.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_1E1AC112.pngIGV_-_Session___Users_sr320_data-genomic... 49KB Jan 02 2017 09:10:44 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_1E1AC112.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_1E1AC117.pngIGV_-_Session___Users_sr320_data-genomic... 49KB Jan 02 2017 09:10:48 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_1E1AC117.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_1E1AC124.pngIGV_-_Session___Users_sr320_data-genomic... 49KB Jan 02 2017 09:11:01 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_1E1AC124.png
IGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_and_halfshell_and_Google_Calendar_-_Week_of_Jan_1__2017_1E1AC5B7.pngIGV_-_Session___Users_sr320_data-genomic... 54KB Jan 02 2017 09:30:33 AMIGV_-_Session___Users_sr320_data-genomic_EPI_igv_session-EPI-010217_xml_and_igv_session-EPI-010217_xml_and_halfshell_and_Google_Calendar_-_Week_of_Jan_1__2017_1E1AC5B7.png
IGV_-_Session___Volumes_web_cnidarian_HS_array_igv_session2_xml_195B7133.pngIGV_-_Session___Volumes_web_cnidarian_HS... 66KB Jun 25 2014 02:05:59 PMIGV_-_Session___Volumes_web_cnidarian_HS_array_igv_session2_xml_195B7133.png
IGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B2A278E.pngIGV_-_Session___Volumes_web_halfshell_20... 59KB Jun 11 2015 01:31:13 PMIGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B2A278E.png
IGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B2F3FCA.pngIGV_-_Session___Volumes_web_halfshell_20... 91KB Jun 15 2015 10:15:55 AMIGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B2F3FCA.png
IGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B3DAC69.pngIGV_-_Session___Volumes_web_halfshell_20... 79KB Jun 26 2015 08:51:06 AMIGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B3DAC69.png
IGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B4EF52B.pngIGV_-_Session___Volumes_web_halfshell_20... 14KB Jul 09 2015 11:29:55 AMIGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B4EF52B.png
IGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B5035C1.pngIGV_-_Session___Volumes_web_halfshell_20... 24KB Jul 10 2015 10:17:45 AMIGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B5035C1.png
IGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B50376A.pngIGV_-_Session___Volumes_web_halfshell_20... 8KB Jul 10 2015 10:24:49 AMIGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B50376A.png
IGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B507917.pngIGV_-_Session___Volumes_web_halfshell_20... 34KB Jul 10 2015 03:05:03 PMIGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_1B507917.png
IGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_and_Array-multi-ind-features_1B3DA9BE.pngIGV_-_Session___Volumes_web_halfshell_20... 35KB Jun 26 2015 08:39:43 AMIGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_and_Array-multi-ind-features_1B3DA9BE.png
IGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_and_Evernote_Premium_1B50795A.pngIGV_-_Session___Volumes_web_halfshell_20... 45KB Jul 10 2015 03:06:08 PMIGV_-_Session___Volumes_web_halfshell_2015-05-comgenbro_igv_session_xml_and_Evernote_Premium_1B50795A.png
IGV_1A9FC45E.pngIGV_1A9FC45E.png 42KB Feb 26 2015 01:15:11 PMIGV_1A9FC45E.png
IGV_1A9FD044.pngIGV_1A9FD044.png 40KB Feb 26 2015 02:05:57 PMIGV_1A9FD044.png
IGV_1A49FA51.pngIGV_1A49FA51.png 21KB Dec 23 2014 11:30:30 AMIGV_1A49FA51.png
IGV_1A97AA9A.pngIGV_1A97AA9A.png 28KB Feb 20 2015 09:47:06 AMIGV_1A97AA9A.png
IGV_1A97AF0C.pngIGV_1A97AF0C.png 28KB Feb 20 2015 10:06:04 AMIGV_1A97AF0C.png
IGV_1A97B085.pngIGV_1A97B085.png 15KB Feb 20 2015 10:12:21 AMIGV_1A97B085.png
IGV_1A97B149.pngIGV_1A97B149.png 22KB Feb 20 2015 10:15:36 AMIGV_1A97B149.png
IGV_1A643337.pngIGV_1A643337.png 58KB Jan 12 2015 08:52:07 AMIGV_1A643337.png
IGV_1AA0C920.pngIGV_1AA0C920.png 25KB Feb 27 2015 07:47:45 AMIGV_1AA0C920.png
IGV_1AA0D065.pngIGV_1AA0D065.png 16KB Feb 27 2015 08:18:46 AMIGV_1AA0D065.png
IGV_1AD2E0F6.pngIGV_1AD2E0F6.png 77KB Apr 06 2015 08:42:46 AMIGV_1AD2E0F6.png
IGV_1AD2E1AC.pngIGV_1AD2E1AC.png 50KB Apr 06 2015 08:45:48 AMIGV_1AD2E1AC.png
IGV_1AD2E1F6.pngIGV_1AD2E1F6.png 65KB Apr 06 2015 08:47:03 AMIGV_1AD2E1F6.png
IGV_1AD2E13E.pngIGV_1AD2E13E.png 70KB Apr 06 2015 08:43:59 AMIGV_1AD2E13E.png
IGV_1AD2E22E.pngIGV_1AD2E22E.png 65KB Apr 06 2015 08:47:58 AMIGV_1AD2E22E.png
IGV_1AD2E26F.pngIGV_1AD2E26F.png 50KB Apr 06 2015 08:49:04 AMIGV_1AD2E26F.png
IGV_1AD2E358.pngIGV_1AD2E358.png 74KB Apr 06 2015 08:52:56 AMIGV_1AD2E358.png
IGV_1AD2E527.pngIGV_1AD2E527.png 50KB Apr 06 2015 09:00:40 AMIGV_1AD2E527.png
IGV_1DD651C4.pngIGV_1DD651C4.png 44KB Nov 11 2016 11:21:42 AMIGV_1DD651C4.png
IGV_1DD6523A.pngIGV_1DD6523A.png 44KB Nov 11 2016 11:23:39 AMIGV_1DD6523A.png
IGV_1DDA1CEC.pngIGV_1DDA1CEC.png 27KB Nov 14 2016 08:25:17 AMIGV_1DDA1CEC.png
IGV_1DDA1E69.pngIGV_1DDA1E69.png 53KB Nov 14 2016 08:31:38 AMIGV_1DDA1E69.png
IGV_1DDA1F41.pngIGV_1DDA1F41.png 12KB Nov 14 2016 08:35:13 AMIGV_1DDA1F41.png
igv_1E325330.pngigv_1E325330.png 433KB Jan 20 2017 06:16:18 AMigv_1E325330.png
IGV_1EF48F46.pngIGV_1EF48F46.png 7KB Jun 16 2017 03:12:25 PMIGV_1EF48F46.png
IGV_1EF491AC.pngIGV_1EF491AC.png 56KB Jun 16 2017 03:22:37 PMIGV_1EF491AC.png
IGV_180F2ACC.pngIGV_180F2ACC.png 23KB Oct 16 2013 01:13:04 PMIGV_180F2ACC.png
IGV_195B2846.pngIGV_195B2846.png 46KB Jun 25 2014 08:54:49 AMIGV_195B2846.png
IGV_195B2941.pngIGV_195B2941.png 52KB Jun 25 2014 08:58:58 AMIGV_195B2941.png
IGV_1940D395.pngIGV_1940D395.png 45KB Jun 05 2014 09:34:32 AMIGV_1940D395.png
IGV_1942079F.pngIGV_1942079F.png 16KB Jun 06 2014 07:28:50 AMIGV_1942079F.png
IGV_and_05-Getting-IGV-ready_1DBAB787.pngIGV_and_05-Getting-IGV-ready_1DBAB787.png 18KB Oct 21 2016 01:52:24 PMIGV_and_05-Getting-IGV-ready_1DBAB787.png
IGV_and_08-Genome-tracking_1EF442C8.pngIGV_and_08-Genome-tracking_1EF442C8.png 18KB Jun 16 2017 09:46:02 AMIGV_and_08-Genome-tracking_1EF442C8.png
IGV_and_Directory_Listing_of__cnidarian__and_CLC_Genomics_Workbench_7_0_4_195B0EAF.pngIGV_and_Directory_Listing_of__cnidarian_... 69KB Jun 25 2014 07:05:37 AMIGV_and_Directory_Listing_of__cnidarian__and_CLC_Genomics_Workbench_7_0_4_195B0EAF.png
IGV_and_Directory_Listing_of__halfshell_2015-02-hs-bedgraph__1AA51EC8.pngIGV_and_Directory_Listing_of__halfshell_... 44KB Mar 02 2015 02:42:17 PMIGV_and_Directory_Listing_of__halfshell_2015-02-hs-bedgraph__1AA51EC8.png
IGV_and_Directory_Listing_of__halfshell_2015-02-hs-bedgraph__1AA51F0D.pngIGV_and_Directory_Listing_of__halfshell_... 44KB Mar 02 2015 02:43:25 PMIGV_and_Directory_Listing_of__halfshell_2015-02-hs-bedgraph__1AA51F0D.png
IGV_and_Directory_Listing_of__halfshell_2015-02-hs-bedgraph__1AA51F1B.pngIGV_and_Directory_Listing_of__halfshell_... 44KB Mar 02 2015 02:43:39 PMIGV_and_Directory_Listing_of__halfshell_2015-02-hs-bedgraph__1AA51F1B.png
IGV_and_Directory_Listing_of__halfshell_2015-02-hs-bedgraph__1AA520D6.pngIGV_and_Directory_Listing_of__halfshell_... 44KB Mar 02 2015 02:51:02 PMIGV_and_Directory_Listing_of__halfshell_2015-02-hs-bedgraph__1AA520D6.png
IGV_and_Genome_Feature_Tracks_·_sr320_qdod_Wiki_19D46FDF.pngIGV_and_Genome_Feature_Tracks_·_sr320_q... 48KB Sep 25 2014 08:44:33 AMIGV_and_Genome_Feature_Tracks_·_sr320_qdod_Wiki_19D46FDF.png
IGV_and_sr320_—_igv.command_—_java_—_80×24_18522A8B.pngIGV_and_sr320_—_igv.command_—_java_... 45KB Dec 06 2013 07:53:50 AMIGV_and_sr320_—_igv.command_—_java_—_80×24_18522A8B.png
IGV_and_sr320_—_igv.command_—_java_—_80×24_18522760.pngIGV_and_sr320_—_igv.command_—_java_... 46KB Dec 06 2013 07:40:18 AMIGV_and_sr320_—_igv.command_—_java_—_80×24_18522760.png
IGV_and_trilobite_1AA0CD6E.pngIGV_and_trilobite_1AA0CD6E.png 15KB Feb 27 2015 08:06:07 AMIGV_and_trilobite_1AA0CD6E.png
IGV_and_trilobite_1AA0CD8A.pngIGV_and_trilobite_1AA0CD8A.png 15KB Feb 27 2015 08:06:34 AMIGV_and_trilobite_1AA0CD8A.png
igv_session_xml_and_IGV_and_owl_fish_washington_edu_scaphapoda_Sean_Geoduck_Analysis_Day10_bedgraphs_EPI-104_percmeth_bedgraph_and_nb-2017_—_python2_7_—_80×24_1E82EF5A.pngigv_session_xml_and_IGV_and_owl_fish_was... 144KB Mar 22 2017 10:43:56 AMigv_session_xml_and_IGV_and_owl_fish_washington_edu_scaphapoda_Sean_Geoduck_Analysis_Day10_bedgraphs_EPI-104_percmeth_bedgraph_and_nb-2017_—_python2_7_—_80×24_1E82EF5A.png
igv___half-shell_1AD2DBDC.pngigv___half-shell_1AD2DBDC.png 129KB Apr 06 2015 08:21:00 AMigv___half-shell_1AD2DBDC.png
Illumina_17CE4FBE.pngIllumina_17CE4FBE.png 75KB Aug 28 2013 08:41:23 AMIllumina_17CE4FBE.png
IMG_0607.JPG_and_2013-08-18_10.49.06.jpg_17C3BA43.pngIMG_0607.JPG_and_2013-08-18_10.49.06.jpg... 1046KB Aug 20 2013 08:00:32 AMIMG_0607.JPG_and_2013-08-18_10.49.06.jpg_17C3BA43.png
IMG_0607.JPG_and_2013-08-18_10.49.06.jpg_17C3091A.pngIMG_0607.JPG_and_2013-08-18_10.49.06.jpg... 1047KB Aug 19 2013 07:24:39 PMIMG_0607.JPG_and_2013-08-18_10.49.06.jpg_17C3091A.png
IMG_0831_1A910442.jpgIMG_0831_1A910442.jpg 1754KB Feb 15 2015 08:43:51 AMIMG_0831_1A910442.jpg
IMG_2915_JPG__9_documents__9_total_pages__1B651C27.pngIMG_2915_JPG__9_documents__9_total_pages... 451KB Jul 26 2015 06:46:18 AMIMG_2915_JPG__9_documents__9_total_pages__1B651C27.png
IMG_2922_JPG__9_documents__9_total_pages__1B651D6C.pngIMG_2922_JPG__9_documents__9_total_pages... 124KB Jul 26 2015 06:51:42 AMIMG_2922_JPG__9_documents__9_total_pages__1B651D6C.png
IMG_2923_JPG__9_documents__9_total_pages__1B6520EF.pngIMG_2923_JPG__9_documents__9_total_pages... 397KB Jul 26 2015 07:06:40 AMIMG_2923_JPG__9_documents__9_total_pages__1B6520EF.png
IMG_2959_JPG__4_documents__4_total_pages__1B7AA359.pngIMG_2959_JPG__4_documents__4_total_pages... 128KB Aug 11 2015 02:40:41 PMIMG_2959_JPG__4_documents__4_total_pages__1B7AA359.png
IMG_3064_JPG_and_Photo_-_Google_Photos_1BA8F645.pngIMG_3064_JPG_and_Photo_-_Google_Photos_1... 842KB Sep 15 2015 05:58:48 PMIMG_3064_JPG_and_Photo_-_Google_Photos_1BA8F645.png
IMG_3068_JPG_1BAB12EF.pngIMG_3068_JPG_1BAB12EF.png 906KB Sep 17 2015 08:25:36 AMIMG_3068_JPG_1BAB12EF.png
IMG_3068_JPG_1BAB14F9.pngIMG_3068_JPG_1BAB14F9.png 906KB Sep 17 2015 08:34:20 AMIMG_3068_JPG_1BAB14F9.png
IMG_3068_JPG_1BAB15E3.pngIMG_3068_JPG_1BAB15E3.png 906KB Sep 17 2015 08:38:13 AMIMG_3068_JPG_1BAB15E3.png
IMG_3073_JPG_1BAB1123.pngIMG_3073_JPG_1BAB1123.png 579KB Sep 17 2015 08:17:56 AMIMG_3073_JPG_1BAB1123.png
IMG_3074_JPG_1BAB11C5.pngIMG_3074_JPG_1BAB11C5.png 310KB Sep 17 2015 08:20:35 AMIMG_3074_JPG_1BAB11C5.png
IMG_3998_JPG_1C73F601.pngIMG_3998_JPG_1C73F601.png 727KB Feb 16 2016 04:27:49 PMIMG_3998_JPG_1C73F601.png
IMG_4003_JPG_1C73F3A3.pngIMG_4003_JPG_1C73F3A3.png 892KB Feb 16 2016 04:17:44 PMIMG_4003_JPG_1C73F3A3.png
IMG_4003_JPG_1C73F53F.pngIMG_4003_JPG_1C73F53F.png 966KB Feb 16 2016 04:24:35 PMIMG_4003_JPG_1C73F53F.png
IMG_4947_JPG__33_documents__33_total_pages__and_Ocean_Acidification_–_Research_Notes_from_the_School_of_Aquatic_and_Fishery_Sciences_1CB95D8F.pngIMG_4947_JPG__33_documents__33_total_pag... 659KB Apr 09 2016 08:56:03 AMIMG_4947_JPG__33_documents__33_total_pages__and_Ocean_Acidification_–_Research_Notes_from_the_School_of_Aquatic_and_Fishery_Sciences_1CB95D8F.png
IMG_4948_JPG__33_documents__33_total_pages__1CB95E0C.pngIMG_4948_JPG__33_documents__33_total_pag... 537KB Apr 09 2016 08:58:06 AMIMG_4948_JPG__33_documents__33_total_pages__1CB95E0C.png
IMG_4949_JPG__33_documents__33_total_pages__1CB95E2B.pngIMG_4949_JPG__33_documents__33_total_pag... 232KB Apr 09 2016 08:58:37 AMIMG_4949_JPG__33_documents__33_total_pages__1CB95E2B.png
IMG_4950_JPG__33_documents__33_total_pages__1CB95E48.pngIMG_4950_JPG__33_documents__33_total_pag... 251KB Apr 09 2016 08:59:06 AMIMG_4950_JPG__33_documents__33_total_pages__1CB95E48.png
IMG_4951_JPG__33_documents__33_total_pages__1CB95E5F.pngIMG_4951_JPG__33_documents__33_total_pag... 311KB Apr 09 2016 08:59:29 AMIMG_4951_JPG__33_documents__33_total_pages__1CB95E5F.png
IMG_4952_JPG__33_documents__33_total_pages__1CB95E75.pngIMG_4952_JPG__33_documents__33_total_pag... 322KB Apr 09 2016 08:59:51 AMIMG_4952_JPG__33_documents__33_total_pages__1CB95E75.png
IMG_4953_JPG__33_documents__33_total_pages__1CB95E93.pngIMG_4953_JPG__33_documents__33_total_pag... 227KB Apr 09 2016 09:00:20 AMIMG_4953_JPG__33_documents__33_total_pages__1CB95E93.png
IMG_4957_JPG__33_documents__33_total_pages__1CB9604A.pngIMG_4957_JPG__33_documents__33_total_pag... 438KB Apr 09 2016 09:07:41 AMIMG_4957_JPG__33_documents__33_total_pages__1CB9604A.png
IMG_4959_JPG__33_documents__33_total_pages__1CB96023.pngIMG_4959_JPG__33_documents__33_total_pag... 600KB Apr 09 2016 09:07:02 AMIMG_4959_JPG__33_documents__33_total_pages__1CB96023.png
IMG_4961_JPG__33_documents__33_total_pages__1CB95EFF.pngIMG_4961_JPG__33_documents__33_total_pag... 431KB Apr 09 2016 09:02:09 AMIMG_4961_JPG__33_documents__33_total_pages__1CB95EFF.png
IMG_4961_JPG__33_documents__33_total_pages__1CB95F55.pngIMG_4961_JPG__33_documents__33_total_pag... 431KB Apr 09 2016 09:03:35 AMIMG_4961_JPG__33_documents__33_total_pages__1CB95F55.png
IMG_4965_JPG__33_documents__33_total_pages__1CB95FD4.pngIMG_4965_JPG__33_documents__33_total_pag... 487KB Apr 09 2016 09:05:48 AMIMG_4965_JPG__33_documents__33_total_pages__1CB95FD4.png
IMG_4967_JPG__33_documents__33_total_pages__1CB95F8D.pngIMG_4967_JPG__33_documents__33_total_pag... 363KB Apr 09 2016 09:04:32 AMIMG_4967_JPG__33_documents__33_total_pages__1CB95F8D.png
IMG_4971_JPG__33_documents__33_total_pages__1CB95FF9.pngIMG_4971_JPG__33_documents__33_total_pag... 573KB Apr 09 2016 09:06:20 AMIMG_4971_JPG__33_documents__33_total_pages__1CB95FF9.png
IMG_4973_JPG__33_documents__33_total_pages__1CB960AD.pngIMG_4973_JPG__33_documents__33_total_pag... 697KB Apr 09 2016 09:09:39 AMIMG_4973_JPG__33_documents__33_total_pages__1CB960AD.png
IMG_4980_JPG__33_documents__33_total_pages__1CB96140.pngIMG_4980_JPG__33_documents__33_total_pag... 621KB Apr 09 2016 09:11:50 AMIMG_4980_JPG__33_documents__33_total_pages__1CB96140.png
IMG_6033_2_JPG_1AF12C08.pngIMG_6033_2_JPG_1AF12C08.png 1662KB Apr 29 2015 08:11:05 AMIMG_6033_2_JPG_1AF12C08.png
Impactstory__Steven_Roberts_and_Impactstory__Steven_Roberts_and_YouTube_1923D882.pngImpactstory__Steven_Roberts_and_Impactst... 377KB May 14 2014 09:59:47 AMImpactstory__Steven_Roberts_and_Impactstory__Steven_Roberts_and_YouTube_1923D882.png
Inbox_–_roberts_sbr_gmail_com_1C7F9007.pngInbox_–_roberts_sbr_gmail_com_1C7F9007... 55KB Feb 25 2016 11:39:54 AMInbox_–_roberts_sbr_gmail_com_1C7F9007.png
Inbox_–_roberts_sbr_gmail_com_1C7F9025.pngInbox_–_roberts_sbr_gmail_com_1C7F9025... 39KB Feb 25 2016 11:40:22 AMInbox_–_roberts_sbr_gmail_com_1C7F9025.png
Inbox_–_roberts_sbr_gmail_com_1C6692A8.pngInbox_–_roberts_sbr_gmail_com_1C6692A8... 64KB Feb 06 2016 12:44:25 PMInbox_–_roberts_sbr_gmail_com_1C6692A8.png
Inbox_–_roberts_sbr_gmail_com_1C66987D.pngInbox_–_roberts_sbr_gmail_com_1C66987D... 32KB Feb 06 2016 01:09:20 PMInbox_–_roberts_sbr_gmail_com_1C66987D.png
Inbox_–_roberts_sbr_gmail_com_1D8A05E6.pngInbox_–_roberts_sbr_gmail_com_1D8A05E6... 251KB Sep 14 2016 03:25:47 PMInbox_–_roberts_sbr_gmail_com_1D8A05E6.png
Inbox_–_roberts_sbr_gmail_com_1D78C9DD.pngInbox_–_roberts_sbr_gmail_com_1D78C9DD... 13KB Sep 01 2016 01:41:19 PMInbox_–_roberts_sbr_gmail_com_1D78C9DD.png
Inbox_–_roberts_sbr_gmail_com_1D302D17.pngInbox_–_roberts_sbr_gmail_com_1D302D17... 17KB Jul 08 2016 11:48:58 AMInbox_–_roberts_sbr_gmail_com_1D302D17.png
Inbox_–_roberts_sbr_gmail_com_1E54F091.pngInbox_–_roberts_sbr_gmail_com_1E54F091... 42KB Feb 15 2017 12:24:50 PMInbox_–_roberts_sbr_gmail_com_1E54F091.png
Index_of__blast_db__19911CBE.pngIndex_of__blast_db__19911CBE.png 98KB Aug 05 2014 07:07:58 AMIndex_of__blast_db__19911CBE.png
Index_of__blast_executables_blast__LATEST__-_Google_Chrome_1BB9AA37.pngIndex_of__blast_executables_blast__LATES... 129KB Sep 28 2015 10:02:48 AMIndex_of__blast_executables_blast__LATEST__-_Google_Chrome_1BB9AA37.png
Index_of__blast_executables_blast__LATEST__-_Google_Chrome_1BB9AA42.pngIndex_of__blast_executables_blast__LATES... 129KB Sep 28 2015 10:02:58 AMIndex_of__blast_executables_blast__LATEST__-_Google_Chrome_1BB9AA42.png
Index_of__blast_executables_LATEST_and_course-btea_01-Local_BLAST_ipynb_at_master_·_sr320_course-btea_1DA2BEC9.pngIndex_of__blast_executables_LATEST_and_c... 170KB Oct 03 2016 09:29:09 AMIndex_of__blast_executables_LATEST_and_course-btea_01-Local_BLAST_ipynb_at_master_·_sr320_course-btea_1DA2BEC9.png
Index_of__genomes_all_GCA_000233375_4_ICSASG_v2_1CDBE833.pngIndex_of__genomes_all_GCA_000233375_4_IC... 133KB May 05 2016 01:44:36 PMIndex_of__genomes_all_GCA_000233375_4_ICSASG_v2_1CDBE833.png
Index_of__nightingales_P_generosa_1BBC1C9F.pngIndex_of__nightingales_P_generosa_1BBC1C... 71KB Sep 30 2015 06:35:29 AMIndex_of__nightingales_P_generosa_1BBC1C9F.png
Index_of__nightingales_P_generosa_1E3D567A.pngIndex_of__nightingales_P_generosa_1E3D56... 85KB Jan 28 2017 02:45:17 PMIndex_of__nightingales_P_generosa_1E3D567A.png
Index_of__nightingales_P_generosa_and_1Password_1BBC1DD9.pngIndex_of__nightingales_P_generosa_and_1P... 72KB Sep 30 2015 06:40:43 AMIndex_of__nightingales_P_generosa_and_1Password_1BBC1DD9.png
Index_of__pub_databases_GO_goa_UNIPROT_1819B065.pngIndex_of__pub_databases_GO_goa_UNIPROT_1... 80KB Oct 24 2013 12:45:43 PMIndex_of__pub_databases_GO_goa_UNIPROT_1819B065.png
Index_of__pub_databases_GO_goa_UNIPROT_1875E863.pngIndex_of__pub_databases_GO_goa_UNIPROT_1... 77KB Jan 02 2014 10:33:08 AMIndex_of__pub_databases_GO_goa_UNIPROT_1875E863.png
Index_of__pub_databases_uniprot_current_release_knowledgebase_idmapping_1875E702.pngIndex_of__pub_databases_uniprot_current_... 39KB Jan 02 2014 10:27:15 AMIndex_of__pub_databases_uniprot_current_release_knowledgebase_idmapping_1875E702.png
Index_of__sra_sra-instant_reads_ByStudy_sra_SRP_SRP028_SRP028178_1A3A076E.pngIndex_of__sra_sra-instant_reads_ByStudy_... 105KB Dec 11 2014 09:10:08 AMIndex_of__sra_sra-instant_reads_ByStudy_sra_SRP_SRP028_SRP028178_1A3A076E.png
Index_of__UW_White_FCC2M5D_Project_White_18C7D302.pngIndex_of__UW_White_FCC2M5D_Project_White... 36KB Mar 05 2014 01:47:52 PMIndex_of__UW_White_FCC2M5D_Project_White_18C7D302.png
Index_of__Volumes_web_Mollusk_bs_larvae_exp_AdapterTrimmed_methratio_files__19198F3E.pngIndex_of__Volumes_web_Mollusk_bs_larvae_... 45KB May 06 2014 02:44:31 PMIndex_of__Volumes_web_Mollusk_bs_larvae_exp_AdapterTrimmed_methratio_files__19198F3E.png
InflammatoryResponse_1CD14B3F.pngInflammatoryResponse_1CD14B3F.png 95KB Apr 27 2016 12:32:19 PMInflammatoryResponse_1CD14B3F.png
Integrative_Environmental_Physiology_-_Schedule_17F0F578.pngIntegrative_Environmental_Physiology_-_S... 205KB Sep 23 2013 03:17:30 PMIntegrative_Environmental_Physiology_-_Schedule_17F0F578.png
Integrative_Environmental_Physiology_1A0FCA94.pngIntegrative_Environmental_Physiology_1A0... 40KB Nov 09 2014 08:15:17 AMIntegrative_Environmental_Physiology_1A0FCA94.png
Integrative_Environmental_Physiology_1A1CFC90.pngIntegrative_Environmental_Physiology_1A1... 18KB Nov 19 2014 08:28:01 AMIntegrative_Environmental_Physiology_1A1CFC90.png
Interspersed_Repeat_Masking_Based_on_Protein_Similarity_1A376D17.pngInterspersed_Repeat_Masking_Based_on_Pro... 127KB Dec 09 2014 09:47:05 AMInterspersed_Repeat_Masking_Based_on_Protein_Similarity_1A376D17.png
intracellular_signaling_-_YouTube_19D9AA38.pngintracellular_signaling_-_YouTube_19D9AA... 94KB Sep 29 2014 07:54:51 AMintracellular_signaling_-_YouTube_19D9AA38.png
Invertebrate_1_0_tsv_1A3B1F1E.pngInvertebrate_1_0_tsv_1A3B1F1E.png 166KB Dec 12 2014 05:03:28 AMInvertebrate_1_0_tsv_1A3B1F1E.png
Ion_Channel_Coupled_Receptors_-_YouTube_19D9A8D0.pngIon_Channel_Coupled_Receptors_-_YouTube_... 56KB Sep 29 2014 07:48:51 AMIon_Channel_Coupled_Receptors_-_YouTube_19D9A8D0.png
iPath2_supplemental_information_1BBEF672.pngiPath2_supplemental_information_1BBEF672... 124KB Oct 02 2015 10:29:23 AMiPath2_supplemental_information_1BBEF672.png
iPath2__Metabolic_overview_map_17A2BAF1.pngiPath2__Metabolic_overview_map_17A2BAF1.png 39KB Jul 26 2013 07:17:17 AMiPath2__Metabolic_overview_map_17A2BAF1.png
iPhoto_1A91059E.pngiPhoto_1A91059E.png 467KB Feb 15 2015 08:49:37 AMiPhoto_1A91059E.png
Islands_of_Seattle___Whole_U_1889EE5C.pngIslands_of_Seattle___Whole_U_1889EE5C.png 9KB Jan 17 2014 03:04:58 PMIslands_of_Seattle___Whole_U_1889EE5C.png
iThoughtsX__mindmap__on_the_Mac_App_Store_1DC234DF.pngiThoughtsX__mindmap__on_the_Mac_App_Stor... 289KB Oct 27 2016 06:13:05 AMiThoughtsX__mindmap__on_the_Mac_App_Store_1DC234DF.png
Jake_Heare_-_Google__19E825AC.pngJake_Heare_-_Google__19E825AC.png 235KB Oct 10 2014 07:33:16 AMJake_Heare_-_Google__19E825AC.png
Jake_Heare_and_Hangouts_and_Schistosoma_epigenetics_-_Google_Search_and_Faculty_Endorsement_Example.docx_185BBC65.pngJake_Heare_and_Hangouts_and_Schistosoma_... 74KB Dec 13 2013 02:06:31 PMJake_Heare_and_Hangouts_and_Schistosoma_epigenetics_-_Google_Search_and_Faculty_Endorsement_Example.docx_185BBC65.png
Jake_Heare_Research_Central__8_10_2015_EF1d_Mech_Stress_2_rep_qPCR_1B821B44.pngJake_Heare_Research_Central__8_10_2015_E... 51KB Aug 17 2015 06:38:11 AMJake_Heare_Research_Central__8_10_2015_EF1d_Mech_Stress_2_rep_qPCR_1B821B44.png
Jake_Heare_Research_Central__8_15_2015_CARM_CTM2_reps_qPCR_1B8274C8.pngJake_Heare_Research_Central__8_15_2015_C... 190KB Aug 17 2015 01:00:11 PMJake_Heare_Research_Central__8_15_2015_CARM_CTM2_reps_qPCR_1B8274C8.png
Jay-CpG_1A9FE9EC.pngJay-CpG_1A9FE9EC.png 12KB Feb 26 2015 03:55:24 PMJay-CpG_1A9FE9EC.png
Jay-CpG_1A9FE9EF.pngJay-CpG_1A9FE9EF.png 12KB Feb 26 2015 03:55:27 PMJay-CpG_1A9FE9EF.png
Jay-join_1A8E91AC.pngJay-join_1A8E91AC.png 185KB Feb 13 2015 12:10:20 PMJay-join_1A8E91AC.png
Jay-join_1A8EEEBF.pngJay-join_1A8EEEBF.png 71KB Feb 13 2015 06:47:29 PMJay-join_1A8EEEBF.png
Jay_s_lab_notebook_1A8E6C1F.pngJay_s_lab_notebook_1A8E6C1F.png 57KB Feb 13 2015 09:30:08 AMJay_s_lab_notebook_1A8E6C1F.png
JBrowse_scaffold624_17744__159191_1CCBD82E.pngJBrowse_scaffold624_17744__159191_1CCBD8... 80KB Apr 23 2016 09:20:02 AMJBrowse_scaffold624_17744__159191_1CCBD82E.png
JBrowse_scaffold860_1__221360_and_Getting_back_on_track_md_1CAD9095.pngJBrowse_scaffold860_1__221360_and_Gettin... 143KB Mar 31 2016 10:06:31 AMJBrowse_scaffold860_1__221360_and_Getting_back_on_track_md_1CAD9095.png
JBrowse_scaffold1179_445001__923000_188EA68B.pngJBrowse_scaffold1179_445001__923000_188E... 77KB Jan 21 2014 05:00:02 AMJBrowse_scaffold1179_445001__923000_188EA68B.png
JBrowse_scaffold3680_9487__72804_1CBB0254.pngJBrowse_scaffold3680_9487__72804_1CBB025... 152KB Apr 10 2016 02:51:21 PMJBrowse_scaffold3680_9487__72804_1CBB0254.png
JBrowse_scaffold3680_9487__72804_1CBB0254_png__1134×790__1CC95D29.pngJBrowse_scaffold3680_9487__72804_1CBB025... 101KB Apr 21 2016 12:10:36 PMJBrowse_scaffold3680_9487__72804_1CBB0254_png__1134×790__1CC95D29.png
JBrowse_scaffold4546_56623__57472_1CAD8E29.pngJBrowse_scaffold4546_56623__57472_1CAD8E... 96KB Mar 31 2016 09:56:09 AMJBrowse_scaffold4546_56623__57472_1CAD8E29.png
JBrowse_scaffold5824_3156__8360_1CEA6B71.pngJBrowse_scaffold5824_3156__8360_1CEA6B71... 61KB May 16 2016 01:56:18 PMJBrowse_scaffold5824_3156__8360_1CEA6B71.png
JBrowse_scaffold15594_1__29574_1E1AE8C9.pngJBrowse_scaffold15594_1__29574_1E1AE8C9.png 200KB Jan 02 2017 12:00:11 PMJBrowse_scaffold15594_1__29574_1E1AE8C9.png
jheare_OluridaSurvey2014_1A3785C0.pngjheare_OluridaSurvey2014_1A3785C0.png 5KB Dec 09 2014 11:32:17 AMjheare_OluridaSurvey2014_1A3785C0.png
jheare_OluridaSurvey2014_1BC01964.pngjheare_OluridaSurvey2014_1BC01964.png 99KB Oct 03 2015 07:10:45 AMjheare_OluridaSurvey2014_1BC01964.png
jldimond-fish546-2016_ddRAD_analysis_md_at_master_·_jldimond_jldimond-fish546-2016_1E09B502.pngjldimond-fish546-2016_ddRAD_analysis_md_... 81KB Dec 20 2016 10:50:42 AMjldimond-fish546-2016_ddRAD_analysis_md_at_master_·_jldimond_jldimond-fish546-2016_1E09B502.png
jldimond-fish546-2016_ddRAD_analysis_md_at_master_·_jldimond_jldimond-fish546-2016_1E09B523.pngjldimond-fish546-2016_ddRAD_analysis_md_... 46KB Dec 20 2016 10:51:16 AMjldimond-fish546-2016_ddRAD_analysis_md_at_master_·_jldimond_jldimond-fish546-2016_1E09B523.png
jldimond-fish546-2016_EpiRAD_analysis_md_at_master_·_jldimond_jldimond-fish546-2016_1E09B4B4.pngjldimond-fish546-2016_EpiRAD_analysis_md... 41KB Dec 20 2016 10:49:27 AMjldimond-fish546-2016_EpiRAD_analysis_md_at_master_·_jldimond_jldimond-fish546-2016_1E09B4B4.png
jldimond-fish546-2016_EpiRAD_analysis_md_at_master_·_jldimond_jldimond-fish546-2016_1E09B4CD.pngjldimond-fish546-2016_EpiRAD_analysis_md... 105KB Dec 20 2016 10:49:50 AMjldimond-fish546-2016_EpiRAD_analysis_md_at_master_·_jldimond_jldimond-fish546-2016_1E09B4CD.png
jldimond_Coral-CpG_1BC01D59.pngjldimond_Coral-CpG_1BC01D59.png 99KB Oct 03 2015 07:27:39 AMjldimond_Coral-CpG_1BC01D59.png
jldimond_jldimond-fish546-2016__FISH546_repository_1E09B73D.pngjldimond_jldimond-fish546-2016__FISH546_... 317KB Dec 20 2016 11:00:14 AMjldimond_jldimond-fish546-2016__FISH546_repository_1E09B73D.png
Job_Descriptions_-_roberts.sbr_gmail.com_-_Gmail_179EE1A1.pngJob_Descriptions_-_roberts.sbr_gmail.com... 7KB Jul 23 2013 09:13:08 AMJob_Descriptions_-_roberts.sbr_gmail.com_-_Gmail_179EE1A1.png
Jonathan_Allen_-_Google__19E82DB4.pngJonathan_Allen_-_Google__19E82DB4.png 300KB Oct 10 2014 08:07:33 AMJonathan_Allen_-_Google__19E82DB4.png
journal_pone_0165231_g007_PNG_1DBAC83C.pngjournal_pone_0165231_g007_PNG_1DBAC83C.png 59KB Oct 21 2016 03:03:44 PMjournal_pone_0165231_g007_PNG_1DBAC83C.png
KarlSeitz_BlogPost_docx_1B1F74F7.pngKarlSeitz_BlogPost_docx_1B1F74F7.png 254KB Jun 03 2015 10:46:31 AMKarlSeitz_BlogPost_docx_1B1F74F7.png
KarlSeitz_BlogPost_docx_1B1F7530.pngKarlSeitz_BlogPost_docx_1B1F7530.png 32KB Jun 03 2015 10:47:28 AMKarlSeitz_BlogPost_docx_1B1F7530.png
Katie_Jackson_-_Google__19E82730.pngKatie_Jackson_-_Google__19E82730.png 211KB Oct 10 2014 07:39:45 AMKatie_Jackson_-_Google__19E82730.png
LabDocs_bash_md_at_master_·_sr320_LabDocs_1A1929E0.pngLabDocs_bash_md_at_master_·_sr320_LabDo... 25KB Nov 16 2014 10:52:18 AMLabDocs_bash_md_at_master_·_sr320_LabDocs_1A1929E0.png
LabDocs_code_at_master_·_sr320_LabDocs_1A192AC2.pngLabDocs_code_at_master_·_sr320_LabDocs_... 30KB Nov 16 2014 10:56:03 AMLabDocs_code_at_master_·_sr320_LabDocs_1A192AC2.png
LabDocs_Proposal_database_md_at_master_·_sr320_LabDocs_1E09B55E.pngLabDocs_Proposal_database_md_at_master_... 150KB Dec 20 2016 10:52:16 AMLabDocs_Proposal_database_md_at_master_·_sr320_LabDocs_1E09B55E.png
Lec1_intro_-_Google_Slides_19DC43D9.pngLec1_intro_-_Google_Slides_19DC43D9.png 49KB Oct 01 2014 07:14:52 AMLec1_intro_-_Google_Slides_19DC43D9.png
Lec4_1AD193B9.pngLec4_1AD193B9.png 80KB Apr 05 2015 09:00:58 AMLec4_1AD193B9.png
Lec7_key_1CBBF03A.pngLec7_key_1CBBF03A.png 108KB Apr 11 2016 07:46:21 AMLec7_key_1CBBF03A.png
Lec7_key_1CBBF044.pngLec7_key_1CBBF044.png 108KB Apr 11 2016 07:46:29 AMLec7_key_1CBBF044.png
Lec7_key_1CBBF061.pngLec7_key_1CBBF061.png 109KB Apr 11 2016 07:46:58 AMLec7_key_1CBBF061.png
Lec12__Metamorphosis__S17_pdf__page_15_of_52__1EB783C6.pngLec12__Metamorphosis__S17_pdf__page_15_o... 16KB May 01 2017 07:55:04 AMLec12__Metamorphosis__S17_pdf__page_15_of_52__1EB783C6.png
Lec13_pdf__page_7_of_77__1B0223D0.pngLec13_pdf__page_7_of_77__1B0223D0.png 54KB May 12 2015 05:04:33 AMLec13_pdf__page_7_of_77__1B0223D0.png
Lec15_pdf__page_15_of_53__1B18A1B7.pngLec15_pdf__page_15_of_53__1B18A1B7.png 166KB May 29 2015 06:31:35 AMLec15_pdf__page_15_of_53__1B18A1B7.png
Lec17_annot_pptx_1E687D6D.pngLec17_annot_pptx_1E687D6D.png 265KB Mar 02 2017 08:18:54 AMLec17_annot_pptx_1E687D6D.png
license_1AFD69AD.pnglicense_1AFD69AD.png 9KB May 08 2015 03:01:18 PMlicense_1AFD69AD.png
Liprin-beta-1_-_Homo_sapiens__Human__18522884.pngLiprin-beta-1_-_Homo_sapiens__Human__185... 132KB Dec 06 2013 07:45:10 AMLiprin-beta-1_-_Homo_sapiens__Human__18522884.png
Lodish_et_al_2000_Gene_Expression_-_YouTube_1D9C45C3.pngLodish_et_al_2000_Gene_Expression_-_YouT... 68KB Sep 28 2016 11:39:03 AMLodish_et_al_2000_Gene_Expression_-_YouTube_1D9C45C3.png
Lodish_et_al_2000_Gene_Expression_-_YouTube_19D5AD56.pngLodish_et_al_2000_Gene_Expression_-_YouT... 127KB Sep 26 2014 07:19:04 AMLodish_et_al_2000_Gene_Expression_-_YouTube_19D5AD56.png
lollipop_18182B28.pnglollipop_18182B28.png 7KB Oct 23 2013 09:04:59 AMlollipop_18182B28.png
lollipop_181810DA.pnglollipop_181810DA.png 7KB Oct 23 2013 07:12:45 AMlollipop_181810DA.png
Long_noncoding_RNAs__lncRNAs__dynamics_evidence_immunomodulation_during_ISAV-Infected_Atlantic_salmon__Salmo_salar____Scientific_Reports_1D899F76.pngLong_noncoding_RNAs__lncRNAs__dynamics_e... 189KB Sep 14 2016 08:08:44 AMLong_noncoding_RNAs__lncRNAs__dynamics_evidence_immunomodulation_during_ISAV-Infected_Atlantic_salmon__Salmo_salar____Scientific_Reports_1D899F76.png
Mackenzie_Gavery_and_UniProtKB_187B1DCD.pngMackenzie_Gavery_and_UniProtKB_187B1DCD.png 285KB Jan 06 2014 09:22:22 AMMackenzie_Gavery_and_UniProtKB_187B1DCD.png
MacQIIME_-_Werner_Lab_1C20417E.pngMacQIIME_-_Werner_Lab_1C20417E.png 60KB Dec 15 2015 04:39:31 AMMacQIIME_-_Werner_Lab_1C20417E.png
maltose-lactose_png_1CBBE41D.pngmaltose-lactose_png_1CBBE41D.png 10KB Apr 11 2016 06:54:39 AMmaltose-lactose_png_1CBBE41D.png
Manual_1DD62833.pngManual_1DD62833.png 102KB Nov 11 2016 08:24:21 AMManual_1DD62833.png
Map_Reads_to_Contigs_1E0D8028.pngMap_Reads_to_Contigs_1E0D8028.png 56KB Dec 23 2016 07:54:17 AMMap_Reads_to_Contigs_1E0D8028.png
MarkdownPad_-_Download_-_Google_Chrome_1BB9B9F1.pngMarkdownPad_-_Download_-_Google_Chrome_1... 105KB Sep 28 2015 11:09:54 AMMarkdownPad_-_Download_-_Google_Chrome_1BB9B9F1.png
Maternity_Hats___Old_Navy_-_Free_Shipping_on__50_1A8D1BD8.pngMaternity_Hats___Old_Navy_-_Free_Shippin... 243KB Feb 12 2015 09:35:21 AMMaternity_Hats___Old_Navy_-_Free_Shipping_on__50_1A8D1BD8.png
MBD-Seq_C._gigas_gill_manuscript_-_Google_Drive_18059D1D.pngMBD-Seq_C._gigas_gill_manuscript_-_Googl... 72KB Oct 09 2013 07:18:06 AMMBD-Seq_C._gigas_gill_manuscript_-_Google_Drive_18059D1D.png
MBD_BSseq_December_2015_·_RobertsLab_project-olympia_oyster-genomic_Wiki_1CBEB490.pngMBD_BSseq_December_2015_·_RobertsLab_pr... 99KB Apr 13 2016 10:08:34 AMMBD_BSseq_December_2015_·_RobertsLab_project-olympia_oyster-genomic_Wiki_1CBEB490.png
MBD_BSseq_December_2015_·_RobertsLab_project-olympia_oyster-genomic_Wiki_1E7AD4C1.pngMBD_BSseq_December_2015_·_RobertsLab_pr... 51KB Mar 16 2017 07:12:18 AMMBD_BSseq_December_2015_·_RobertsLab_project-olympia_oyster-genomic_Wiki_1E7AD4C1.png
MBD_Enrichment_for_Sequencing_at_ZymoResearch___Sam_s_Notebook_1C4FF251.pngMBD_Enrichment_for_Sequencing_at_ZymoRes... 33KB Jan 20 2016 08:50:25 AMMBD_Enrichment_for_Sequencing_at_ZymoResearch___Sam_s_Notebook_1C4FF251.png
MDA-5_RIG-I_-_BioSystems_-_NCBI_and_Messages__3_unread__199D8291.pngMDA-5_RIG-I_-_BioSystems_-_NCBI_and_Mess... 139KB Aug 14 2014 04:49:39 PMMDA-5_RIG-I_-_BioSystems_-_NCBI_and_Messages__3_unread__199D8291.png
Menubar_and_Enter_URL_to__genome_or_FASTA_file_and_IGV_1A5F1262.pngMenubar_and_Enter_URL_to__genome_or_FAST... 58KB Jan 08 2015 11:30:42 AMMenubar_and_Enter_URL_to__genome_or_FASTA_file_and_IGV_1A5F1262.png
Merv_fig.key_18182B7B.pngMerv_fig.key_18182B7B.png 7KB Oct 23 2013 09:06:21 AMMerv_fig.key_18182B7B.png
methyl-CpG_binding_-_BioSystems_-_NCBI_and_sr320_and_invert_review_17BE6662.pngmethyl-CpG_binding_-_BioSystems_-_NCBI_a... 145KB Aug 16 2013 07:01:04 AMmethyl-CpG_binding_-_BioSystems_-_NCBI_and_sr320_and_invert_review_17BE6662.png
methylkit_-_R_package_for_DNA_methylation_analysis_-_Google_Project_Hosting_18E63628.pngmethylkit_-_R_package_for_DNA_methylatio... 14KB Mar 28 2014 03:58:50 PMmethylkit_-_R_package_for_DNA_methylation_analysis_-_Google_Project_Hosting_18E63628.png
mf-fish546-PCod_Lanes_1_and_2_combined__Analyses___Results_ipynb_at_master_·_mfisher5_mf-fish546-PCod_1E084860.pngmf-fish546-PCod_Lanes_1_and_2_combined__... 106KB Dec 19 2016 08:54:57 AMmf-fish546-PCod_Lanes_1_and_2_combined__Analyses___Results_ipynb_at_master_·_mfisher5_mf-fish546-PCod_1E084860.png
mfisher5_mf-fish546-PCod_at_v1_0_1E0847A9.pngmfisher5_mf-fish546-PCod_at_v1_0_1E0847A... 554KB Dec 19 2016 08:51:54 AMmfisher5_mf-fish546-PCod_at_v1_0_1E0847A9.png
MINGW64__c_Users_sr320_Desktop_1BB99F45.pngMINGW64__c_Users_sr320_Desktop_1BB99F45.png 25KB Sep 28 2015 09:16:06 AMMINGW64__c_Users_sr320_Desktop_1BB99F45.png
Mollusca__Metabolic_Biochemistry_and_Molecular_Biomechanics_-_Google_Books_1AEEC243.pngMollusca__Metabolic_Biochemistry_and_Mol... 159KB Apr 27 2015 12:15:16 PMMollusca__Metabolic_Biochemistry_and_Molecular_Biomechanics_-_Google_Books_1AEEC243.png
Montipora_Spawn_Timing_Mcap_Spawn_analysis_script_md_at_master_·_hputnam_Montipora_Spawn_Timing_1DBEC543.pngMontipora_Spawn_Timing_Mcap_Spawn_analys... 106KB Oct 24 2016 03:40:11 PMMontipora_Spawn_Timing_Mcap_Spawn_analysis_script_md_at_master_·_hputnam_Montipora_Spawn_Timing_1DBEC543.png
More_Bismark_output_tests_1DEB4908.pngMore_Bismark_output_tests_1DEB4908.png 80KB Nov 27 2016 09:02:05 AMMore_Bismark_output_tests_1DEB4908.png
MultiQC_Report_1DB7BD6C.pngMultiQC_Report_1DB7BD6C.png 206KB Oct 19 2016 07:40:48 AMMultiQC_Report_1DB7BD6C.png
MultiQC_Report_1DB7BDA9.pngMultiQC_Report_1DB7BDA9.png 51KB Oct 19 2016 07:41:46 AMMultiQC_Report_1DB7BDA9.png
MultiQC_Report_1DB7BDB3.pngMultiQC_Report_1DB7BDB3.png 51KB Oct 19 2016 07:41:55 AMMultiQC_Report_1DB7BDB3.png
MultiQC_Report_1DB7BDEE.pngMultiQC_Report_1DB7BDEE.png 89KB Oct 19 2016 07:42:54 AMMultiQC_Report_1DB7BDEE.png
MultiQC_Report_1DB7BE31.pngMultiQC_Report_1DB7BE31.png 55KB Oct 19 2016 07:44:02 AMMultiQC_Report_1DB7BE31.png
MyFinancial.desktop__My_Budget_List_181704DF.pngMyFinancial.desktop__My_Budget_List_1817... 61KB Oct 22 2013 12:09:23 PMMyFinancial.desktop__My_Budget_List_181704DF.png
MyFinancial_desktop__Budget_Summary_Report_1E3690EF.pngMyFinancial_desktop__Budget_Summary_Repo... 195KB Jan 23 2017 11:28:49 AMMyFinancial_desktop__Budget_Summary_Report_1E3690EF.png
MyFinancial_desktop__Reconciliation_1D00A2CA.pngMyFinancial_desktop__Reconciliation_1D00... 41KB Jun 02 2016 10:22:22 AMMyFinancial_desktop__Reconciliation_1D00A2CA.png
MyFinancial_desktop__Reconciliation_18E60C99.pngMyFinancial_desktop__Reconciliation_18E6... 31KB Mar 28 2014 01:01:30 PMMyFinancial_desktop__Reconciliation_18E60C99.png
Mytilus_-_SRA_-_NCBI_1C21BE5F.pngMytilus_-_SRA_-_NCBI_1C21BE5F.png 188KB Dec 16 2015 07:44:40 AMMytilus_-_SRA_-_NCBI_1C21BE5F.png
My_Class_Resources_-_Photo_Class_List_19D5B4CC.pngMy_Class_Resources_-_Photo_Class_List_19... 17KB Sep 26 2014 07:50:53 AMMy_Class_Resources_-_Photo_Class_List_19D5B4CC.png
My_Class_Resources_-_Photo_Class_List_19D5B6B6.pngMy_Class_Resources_-_Photo_Class_List_19... 16KB Sep 26 2014 07:59:03 AMMy_Class_Resources_-_Photo_Class_List_19D5B6B6.png
My_Class_Resources_-_Photo_Class_List_19D5B6DB.pngMy_Class_Resources_-_Photo_Class_List_19... 16KB Sep 26 2014 07:59:40 AMMy_Class_Resources_-_Photo_Class_List_19D5B6DB.png
My_Class_Resources_-_Photo_Class_List_19D5B65C.pngMy_Class_Resources_-_Photo_Class_List_19... 16KB Sep 26 2014 07:57:33 AMMy_Class_Resources_-_Photo_Class_List_19D5B65C.png
My_Class_Resources_-_Photo_Class_List_19D5B66E.pngMy_Class_Resources_-_Photo_Class_List_19... 17KB Sep 26 2014 07:57:51 AMMy_Class_Resources_-_Photo_Class_List_19D5B66E.png
My_Class_Resources_-_Photo_Class_List_19D5B68C.pngMy_Class_Resources_-_Photo_Class_List_19... 17KB Sep 26 2014 07:58:21 AMMy_Class_Resources_-_Photo_Class_List_19D5B68C.png
My_Class_Resources_-_Photo_Class_List_19D5B166.pngMy_Class_Resources_-_Photo_Class_List_19... 29KB Sep 26 2014 07:36:23 AMMy_Class_Resources_-_Photo_Class_List_19D5B166.png
My_Class_Resources_-_Photo_Class_List_19D5B377.pngMy_Class_Resources_-_Photo_Class_List_19... 19KB Sep 26 2014 07:45:12 AMMy_Class_Resources_-_Photo_Class_List_19D5B377.png
My_Class_Resources_-_Photo_Class_List_19D5B391.pngMy_Class_Resources_-_Photo_Class_List_19... 19KB Sep 26 2014 07:45:38 AMMy_Class_Resources_-_Photo_Class_List_19D5B391.png
My_Class_Resources_-_Photo_Class_List_19D5B404.pngMy_Class_Resources_-_Photo_Class_List_19... 18KB Sep 26 2014 07:47:33 AMMy_Class_Resources_-_Photo_Class_List_19D5B404.png
My_Class_Resources_-_Photo_Class_List_19D5B470.pngMy_Class_Resources_-_Photo_Class_List_19... 19KB Sep 26 2014 07:49:21 AMMy_Class_Resources_-_Photo_Class_List_19D5B470.png
My_Class_Resources_-_Photo_Class_List_19D5B485.pngMy_Class_Resources_-_Photo_Class_List_19... 17KB Sep 26 2014 07:49:42 AMMy_Class_Resources_-_Photo_Class_List_19D5B485.png
My_Class_Resources_-_Photo_Class_List_19D5B610.pngMy_Class_Resources_-_Photo_Class_List_19... 16KB Sep 26 2014 07:56:17 AMMy_Class_Resources_-_Photo_Class_List_19D5B610.png
My_Class_Resources_-_Photo_Class_List_19D5B620.pngMy_Class_Resources_-_Photo_Class_List_19... 16KB Sep 26 2014 07:56:33 AMMy_Class_Resources_-_Photo_Class_List_19D5B620.png
My_Class_Resources_-_Photo_Class_List_19D5B633.pngMy_Class_Resources_-_Photo_Class_List_19... 16KB Sep 26 2014 07:56:52 AMMy_Class_Resources_-_Photo_Class_List_19D5B633.png
National_Center_for_Biotechnology_Information_1BD90BAE.pngNational_Center_for_Biotechnology_Inform... 180KB Oct 22 2015 05:18:57 AMNational_Center_for_Biotechnology_Information_1BD90BAE.png
National_Center_for_Biotechnology_Information_1BD90BD1.pngNational_Center_for_Biotechnology_Inform... 184KB Oct 22 2015 05:19:30 AMNational_Center_for_Biotechnology_Information_1BD90BD1.png
National_Center_for_Biotechnology_Information_187C9A28.pngNational_Center_for_Biotechnology_Inform... 77KB Jan 07 2014 12:25:18 PMNational_Center_for_Biotechnology_Information_187C9A28.png
National_Science_Foundation_Research_Traineeship_Program__NRT____NSF_-_National_Science_Foundation_1D9C524A.pngNational_Science_Foundation_Research_Tra... 30KB Sep 28 2016 12:32:30 PMNational_Science_Foundation_Research_Traineeship_Program__NRT____NSF_-_National_Science_Foundation_1D9C524A.png
nb-2016_GBS-pyrad-2_ipynb_at_master_·_sr320_nb-2016_1CF64D0F.pngnb-2016_GBS-pyrad-2_ipynb_at_master_·_s... 213KB May 25 2016 02:13:54 PMnb-2016_GBS-pyrad-2_ipynb_at_master_·_sr320_nb-2016_1CF64D0F.png
nb-2017_00-Protein-database_ipynb_at_master_·_sr320_nb-2017_1E4E4FFE.pngnb-2017_00-Protein-database_ipynb_at_mas... 308KB Feb 10 2017 11:46:07 AMnb-2017_00-Protein-database_ipynb_at_master_·_sr320_nb-2017_1E4E4FFE.png
nbviewer.ipython.org_url_eagle.fish.washington.edu_dermochelys_Bioinformatics_Module_2.ipynb_1891C215.pngnbviewer.ipython.org_url_eagle.fish.wash... 32KB Jan 23 2014 01:34:29 PMnbviewer.ipython.org_url_eagle.fish.washington.edu_dermochelys_Bioinformatics_Module_2.ipynb_1891C215.png
nbviewer_ipython_org_gist_sr320_7196b3d440d40c6fcb9a_Genomic-location-of-DMLs_1A8031EF.pngnbviewer_ipython_org_gist_sr320_7196b3d4... 20KB Feb 02 2015 02:30:09 PMnbviewer_ipython_org_gist_sr320_7196b3d440d40c6fcb9a_Genomic-location-of-DMLs_1A8031EF.png
nbviewer_ipython_org_gist_sr320_7196b3d440d40c6fcb9a_Genomic-location-of-DMLs_1A80321A.pngnbviewer_ipython_org_gist_sr320_7196b3d4... 113KB Feb 02 2015 02:30:51 PMnbviewer_ipython_org_gist_sr320_7196b3d440d40c6fcb9a_Genomic-location-of-DMLs_1A80321A.png
nbviewer_ipython_org_url_owl_fish_washington_edu_lilmax_diseases_steven_Comparing_to_Sea_Urchin_ipynb_199BCBB9.pngnbviewer_ipython_org_url_owl_fish_washin... 81KB Aug 13 2014 09:37:12 AMnbviewer_ipython_org_url_owl_fish_washington_edu_lilmax_diseases_steven_Comparing_to_Sea_Urchin_ipynb_199BCBB9.png
ncb0908-1015_pdf__page_1_of_2__1A571B7B.pngncb0908-1015_pdf__page_1_of_2__1A571B7B.png 50KB Jan 02 2015 10:31:24 AMncb0908-1015_pdf__page_1_of_2__1A571B7B.png
NCBI_Blast_comp95_c0_seq1_len_236_path__41153_0-99_35145_100-235__1BF64703.pngNCBI_Blast_comp95_c0_seq1_len_236_path__... 86KB Nov 13 2015 08:27:48 AMNCBI_Blast_comp95_c0_seq1_len_236_path__41153_0-99_35145_100-235__1BF64703.png
NCBI_Blast_gb_FJ469996_1___575_letters__19806D85.pngNCBI_Blast_gb_FJ469996_1___575_letters__... 112KB Jul 23 2014 03:24:05 PMNCBI_Blast_gb_FJ469996_1___575_letters__19806D85.png
NCBI_Blast_gb_FJ469996_1___575_letters__and_CLC_Sequence_Viewer_6_6_1_19806E78.pngNCBI_Blast_gb_FJ469996_1___575_letters__... 32KB Jul 23 2014 03:28:08 PMNCBI_Blast_gb_FJ469996_1___575_letters__and_CLC_Sequence_Viewer_6_6_1_19806E78.png
NCBI_Blast_Nucleotide_Sequence__50_letters__1A8C53B0.pngNCBI_Blast_Nucleotide_Sequence__50_lette... 42KB Feb 11 2015 07:21:22 PMNCBI_Blast_Nucleotide_Sequence__50_letters__1A8C53B0.png
NCBI_Blast_Nucleotide_Sequence__105327_letters__19897A52.pngNCBI_Blast_Nucleotide_Sequence__105327_l... 104KB Jul 30 2014 12:09:07 PMNCBI_Blast_Nucleotide_Sequence__105327_letters__19897A52.png
NCBI_Blast_Phel_clc_contig_2671_CGTCGTCGAGGACTCCTGCTTCGCCGATGGTCATGCCCCCATCCTCTTGGCACAGATCCAGCAGTGCTTGTCGGGCCACTTCGACCTCGACCATTCGACGCTACAGCTAGAACCACCCCGGCACGCCGGCACCGAAAATCAAACGATGTGACGCGAAGGGGTCCCAGCTCGGAGGCTAGGACCCCATGATCTTGCATGATTACTGAGC_19882827.pngNCBI_Blast_Phel_clc_contig_2671_CGTCGTCG... 49KB Jul 29 2014 12:06:17 PMNCBI_Blast_Phel_clc_contig_2671_CGTCGTCGAGGACTCCTGCTTCGCCGATGGTCATGCCCCCATCCTCTTGGCACAGATCCAGCAGTGCTTGTCGGGCCACTTCGACCTCGACCATTCGACGCTACAGCTAGAACCACCCCGGCACGCCGGCACCGAAAATCAAACGATGTGACGCGAAGGGGTCCCAGCTCGGAGGCTAGGACCCCATGATCTTGCATGATTACTGAGC_19882827.png
New_Issue_·_hputnam_project_juvenile_geoduck_OA_1E4B6A83.pngNew_Issue_·_hputnam_project_juvenile_ge... 90KB Feb 08 2017 07:02:29 AMNew_Issue_·_hputnam_project_juvenile_geoduck_OA_1E4B6A83.png
New_Issue_·_sr320_LabDocs_1A5B5B2D.pngNew_Issue_·_sr320_LabDocs_1A5B5B2D.png 38KB Jan 05 2015 03:52:13 PMNew_Issue_·_sr320_LabDocs_1A5B5B2D.png
Next_Gen_Seq_Library_Database_-_Google_Sheets_1C4FE9FC.pngNext_Gen_Seq_Library_Database_-_Google_S... 52KB Jan 20 2016 08:14:54 AMNext_Gen_Seq_Library_Database_-_Google_Sheets_1C4FE9FC.png
Next_Gen_Seq_Library_Database_-_Google_Sheets_1DAD206E.pngNext_Gen_Seq_Library_Database_-_Google_S... 26KB Oct 11 2016 06:28:35 AMNext_Gen_Seq_Library_Database_-_Google_Sheets_1DAD206E.png
Next_Gen_Seq_Library_Database_1A424204.pngNext_Gen_Seq_Library_Database_1A424204.png 72KB Dec 17 2014 02:58:13 PMNext_Gen_Seq_Library_Database_1A424204.png
NGS_Raw_Data_-_837.8_GB_17A0A4B5.pngNGS_Raw_Data_-_837.8_GB_17A0A4B5.png 533KB Jul 24 2013 05:17:47 PMNGS_Raw_Data_-_837.8_GB_17A0A4B5.png
NGS_Raw_Data_17A1B3BA.pngNGS_Raw_Data_17A1B3BA.png 25KB Jul 25 2013 12:34:11 PMNGS_Raw_Data_17A1B3BA.png
NGS_Raw_Data_1952234B.pngNGS_Raw_Data_1952234B.png 155KB Jun 18 2014 12:43:10 PMNGS_Raw_Data_1952234B.png
Nightingales_-_Google_Fusion_Tables_1A424778.pngNightingales_-_Google_Fusion_Tables_1A42... 40KB Dec 17 2014 03:21:29 PMNightingales_-_Google_Fusion_Tables_1A424778.png
Nightingales_-_Google_Fusion_Tables_1A424859.pngNightingales_-_Google_Fusion_Tables_1A42... 40KB Dec 17 2014 03:25:14 PMNightingales_-_Google_Fusion_Tables_1A424859.png
Nightingales_-_Google_Fusion_Tables_1B2B4B37.pngNightingales_-_Google_Fusion_Tables_1B2B... 49KB Jun 12 2015 10:15:36 AMNightingales_-_Google_Fusion_Tables_1B2B4B37.png
Nightingales_-_Google_Fusion_Tables_1970319C.pngNightingales_-_Google_Fusion_Tables_1970... 43KB Jul 11 2014 07:52:11 AMNightingales_-_Google_Fusion_Tables_1970319C.png
Nightingales_-_Google_Sheets_1EF883CC.pngNightingales_-_Google_Sheets_1EF883CC.png 232KB Jun 19 2017 03:12:30 PMNightingales_-_Google_Sheets_1EF883CC.png
Nightingales_-_Google_Sheets_and_nightingales_1E7AD99F.pngNightingales_-_Google_Sheets_and_nightin... 350KB Mar 16 2017 07:33:04 AMNightingales_-_Google_Sheets_and_nightingales_1E7AD99F.png
NoNA_csv_1E7C619D.pngNoNA_csv_1E7C619D.png 215KB Mar 17 2017 11:25:35 AMNoNA_csv_1E7C619D.png
Notebook.key_17A95E26.pngNotebook.key_17A95E26.png 217KB Jul 31 2013 08:07:30 AMNotebook.key_17A95E26.png
Notepad___Home_-_Google_Chrome_1BB9B931.pngNotepad___Home_-_Google_Chrome_1BB9B931.png 645KB Sep 28 2015 11:06:42 AMNotepad___Home_-_Google_Chrome_1BB9B931.png
NRSP8_Aquaculture_Genome_Proposal_Invoicing_-_roberts.sbr_gmail.com_-_Gmail_17B00A05.pngNRSP8_Aquaculture_Genome_Proposal_Invoic... 140KB Aug 05 2013 09:34:40 AMNRSP8_Aquaculture_Genome_Proposal_Invoicing_-_roberts.sbr_gmail.com_-_Gmail_17B00A05.png
NRSP8_Aquaculture_Genome_Proposal_Invoicing_-_roberts.sbr_gmail.com_-_Gmail_17B009BA.pngNRSP8_Aquaculture_Genome_Proposal_Invoic... 133KB Aug 05 2013 09:33:25 AMNRSP8_Aquaculture_Genome_Proposal_Invoicing_-_roberts.sbr_gmail.com_-_Gmail_17B009BA.png
Nucella_lapillus_transcriptome_annotation_1ABCC7F6.pngNucella_lapillus_transcriptome_annotatio... 101KB Mar 20 2015 02:26:14 PMNucella_lapillus_transcriptome_annotation_1ABCC7F6.png
Nucleotide_BLAST__Search_nucleotide_databases_using_a_nucleotide_query_1AF3CA1C.pngNucleotide_BLAST__Search_nucleotide_data... 167KB May 01 2015 07:50:04 AMNucleotide_BLAST__Search_nucleotide_databases_using_a_nucleotide_query_1AF3CA1C.png
Nucleotide_BLAST__Search_nucleotide_databases_using_a_nucleotide_query_1AF3CA29.pngNucleotide_BLAST__Search_nucleotide_data... 167KB May 01 2015 07:50:17 AMNucleotide_BLAST__Search_nucleotide_databases_using_a_nucleotide_query_1AF3CA29.png
Nunn_pdf__1_page__1E84401E.pngNunn_pdf__1_page__1E84401E.png 455KB Mar 23 2017 10:40:50 AMNunn_pdf__1_page__1E84401E.png
OA-MS_Proteome_ms_-_Google_Drive_and_OA-MS_Proteome_ms_-_Google_Drive_179EF258.pngOA-MS_Proteome_ms_-_Google_Drive_and_OA-... 85KB Jul 23 2013 10:24:26 AMOA-MS_Proteome_ms_-_Google_Drive_and_OA-MS_Proteome_ms_-_Google_Drive_179EF258.png
oa_17E9F332.pngoa_17E9F332.png 62KB Sep 18 2013 07:41:55 AMoa_17E9F332.png
Ocean_Acidification_–_Research_Notes_from_the_School_of_Aquatic_and_Fishery_Sciences_1C87AF9B.pngOcean_Acidification_–_Research_Notes_f... 205KB Mar 02 2016 03:32:47 PMOcean_Acidification_–_Research_Notes_from_the_School_of_Aquatic_and_Fishery_Sciences_1C87AF9B.png
Ocean_Acidification_–_Research_Notes_from_the_School_of_Aquatic_and_Fishery_Sciences_1CE4BEF3.pngOcean_Acidification_–_Research_Notes_f... 391KB May 12 2016 06:39:02 AMOcean_Acidification_–_Research_Notes_from_the_School_of_Aquatic_and_Fishery_Sciences_1CE4BEF3.png
Ocean_Acidification_–_Research_Notes_from_the_School_of_Aquatic_and_Fishery_Sciences_1CE4BF2E.pngOcean_Acidification_–_Research_Notes_f... 391KB May 12 2016 06:40:00 AMOcean_Acidification_–_Research_Notes_from_the_School_of_Aquatic_and_Fishery_Sciences_1CE4BF2E.png
olson-ms-nb_BiGo_dev_ipynb_at_master_·_che625_olson-ms-nb_1BC2FCC5.pngolson-ms-nb_BiGo_dev_ipynb_at_master_·_... 121KB Oct 05 2015 11:45:26 AMolson-ms-nb_BiGo_dev_ipynb_at_master_·_che625_olson-ms-nb_1BC2FCC5.png
OlsonandRoberts2015_9_docx_1BC2FBAE.pngOlsonandRoberts2015_9_docx_1BC2FBAE.png 15KB Oct 05 2015 11:40:49 AMOlsonandRoberts2015_9_docx_1BC2FBAE.png
OluridaSurvey2014__JSR_-_Zenodo_1BC01903.pngOluridaSurvey2014__JSR_-_Zenodo_1BC01903... 235KB Oct 03 2015 07:09:09 AMOluridaSurvey2014__JSR_-_Zenodo_1BC01903.png
Olympia_—_oystergen_es_1AD0C68B.pngOlympia_—_oystergen_es_1AD0C68B.png 978KB Apr 04 2015 06:25:35 PMOlympia_—_oystergen_es_1AD0C68B.png
OlyOv6_1BBEE01A.pngOlyOv6_1BBEE01A.png 95KB Oct 02 2015 08:54:03 AMOlyOv6_1BBEE01A.png
OlyOv6_1BBF222F.pngOlyOv6_1BBF222F.png 45KB Oct 02 2015 01:36:02 PMOlyOv6_1BBF222F.png
OlyOv6_combined_R1_fastq_FastQC_Report_1BBEE0AB.pngOlyOv6_combined_R1_fastq_FastQC_Report_1... 32KB Oct 02 2015 08:56:28 AMOlyOv6_combined_R1_fastq_FastQC_Report_1BBEE0AB.png
OlyOv6_combined_R1_fastq_FastQC_Report_1BBEE058.pngOlyOv6_combined_R1_fastq_FastQC_Report_1... 121KB Oct 02 2015 08:55:05 AMOlyOv6_combined_R1_fastq_FastQC_Report_1BBEE058.png
OlyOv6_combined_R1_fastq_FastQC_Report_1BBEE088.pngOlyOv6_combined_R1_fastq_FastQC_Report_1... 49KB Oct 02 2015 08:55:52 AMOlyOv6_combined_R1_fastq_FastQC_Report_1BBEE088.png
OlyOv6_combined_R2_fastq_FastQC_Report_1BBEE46A.pngOlyOv6_combined_R2_fastq_FastQC_Report_1... 33KB Oct 02 2015 09:12:29 AMOlyOv6_combined_R2_fastq_FastQC_Report_1BBEE46A.png
olyo_-_August_2013_outplanting_1A01889A.pngolyo_-_August_2013_outplanting_1A01889A.png 142KB Oct 29 2014 01:42:04 PMolyo_-_August_2013_outplanting_1A01889A.png
olyo_-_home_188DDB31.pngolyo_-_home_188DDB31.png 141KB Jan 20 2014 02:32:23 PMolyo_-_home_188DDB31.png
olyo_-_Manchester_Visit_4-30-14_1CC95E32.pngolyo_-_Manchester_Visit_4-30-14_1CC95E32... 476KB Apr 21 2016 12:15:00 PMolyo_-_Manchester_Visit_4-30-14_1CC95E32.png
OlyPosterAA3_pdf_18E6FCBA.pngOlyPosterAA3_pdf_18E6FCBA.png 220KB Mar 29 2014 06:06:04 AMOlyPosterAA3_pdf_18E6FCBA.png
oly_1B651FB8.pngoly_1B651FB8.png 328KB Jul 26 2015 07:01:30 AMoly_1B651FB8.png
onlinelibrary_wiley_com_doi_10_1111_j_1755-0998_2010_02936_x_epdf_1DECDF27.pngonlinelibrary_wiley_com_doi_10_1111_j_17... 86KB Nov 28 2016 01:54:49 PMonlinelibrary_wiley_com_doi_10_1111_j_1755-0998_2010_02936_x_epdf_1DECDF27.png
onlinelibrary_wiley_com_doi_10_1111_j_1755-0998_2010_02936_x_epdf_1DECDF55.pngonlinelibrary_wiley_com_doi_10_1111_j_17... 40KB Nov 28 2016 01:55:34 PMonlinelibrary_wiley_com_doi_10_1111_j_1755-0998_2010_02936_x_epdf_1DECDF55.png
onlinelibrary_wiley_com_doi_10_1111_j_1755-0998_2010_02936_x_epdf_1DECDF71.pngonlinelibrary_wiley_com_doi_10_1111_j_17... 85KB Nov 28 2016 01:56:01 PMonlinelibrary_wiley_com_doi_10_1111_j_1755-0998_2010_02936_x_epdf_1DECDF71.png
onlinelibrary_wiley_com_doi_10_1111_j_1755-0998_2010_02936_x_epdf_1DECDFA8.pngonlinelibrary_wiley_com_doi_10_1111_j_17... 44KB Nov 28 2016 01:56:57 PMonlinelibrary_wiley_com_doi_10_1111_j_1755-0998_2010_02936_x_epdf_1DECDFA8.png
onlinelibrary_wiley_com_doi_10_1111_j_1755-0998_2010_02936_x_epdf_1DECDFE6.pngonlinelibrary_wiley_com_doi_10_1111_j_17... 69KB Nov 28 2016 01:57:58 PMonlinelibrary_wiley_com_doi_10_1111_j_1755-0998_2010_02936_x_epdf_1DECDFE6.png
onlinelibrary_wiley_com_doi_10_1111_mec_13414_epdf_1DF9C710.pngonlinelibrary_wiley_com_doi_10_1111_mec_... 69KB Dec 08 2016 08:51:29 AMonlinelibrary_wiley_com_doi_10_1111_mec_13414_epdf_1DF9C710.png
Ostrea_lurida_Data_Descriptor_-_Google_Docs_1C6CD9A2.pngOstrea_lurida_Data_Descriptor_-_Google_D... 499KB Feb 11 2016 07:00:43 AMOstrea_lurida_Data_Descriptor_-_Google_Docs_1C6CD9A2.png
Ostrea_lurida_Data_Descriptor_-_Google_Docs_1C6CD9BB.pngOstrea_lurida_Data_Descriptor_-_Google_D... 64KB Feb 11 2016 07:01:06 AMOstrea_lurida_Data_Descriptor_-_Google_Docs_1C6CD9BB.png
Ostrea_lurida_RADSeq_Process_1ABCC82B.pngOstrea_lurida_RADSeq_Process_1ABCC82B.png 114KB Mar 20 2015 02:27:07 PMOstrea_lurida_RADSeq_Process_1ABCC82B.png
out_1A38A41D.pngout_1A38A41D.png 38KB Dec 10 2014 07:54:07 AMout_1A38A41D.png
out_1A38A422.pngout_1A38A422.png 38KB Dec 10 2014 07:54:11 AMout_1A38A422.png
Owl_1E143CDE.pngOwl_1E143CDE.png 78KB Dec 28 2016 10:33:05 AMOwl_1E143CDE.png
owl_fish_washington_edu_halfshell_2015-02-dmr-canonical_2014_07_02_2M_sig_bedGraph_and_IGV_-_Session__http___owl_fish_washington_edu_halfshell_2016-11-oly-annotation_igv-session_2016-11-14_xml_1E68BC61.pngowl_fish_washington_edu_halfshell_2015-0... 83KB Mar 02 2017 12:47:30 PMowl_fish_washington_edu_halfshell_2015-02-dmr-canonical_2014_07_02_2M_sig_bedGraph_and_IGV_-_Session__http___owl_fish_washington_edu_halfshell_2016-11-oly-annotation_igv-session_2016-11-14_xml_1E68BC61.png
oyster_and_Products_–_Roberts_Lab_1C519607.pngoyster_and_Products_–_Roberts_Lab_1C51... 309KB Jan 21 2016 02:41:13 PMoyster_and_Products_–_Roberts_Lab_1C519607.png
O_luridaSurvey_V4_JSR_docx_1CC80880.pngO_luridaSurvey_V4_JSR_docx_1CC80880.png 84KB Apr 20 2016 11:57:06 AMO_luridaSurvey_V4_JSR_docx_1CC80880.png
O_luridaSurvey_V4_JSR_docx_1CC80910.pngO_luridaSurvey_V4_JSR_docx_1CC80910.png 99KB Apr 20 2016 11:59:28 AMO_luridaSurvey_V4_JSR_docx_1CC80910.png
O_luridaSurvey_V4_JSR_docx_1CC80923.pngO_luridaSurvey_V4_JSR_docx_1CC80923.png 98KB Apr 20 2016 11:59:47 AMO_luridaSurvey_V4_JSR_docx_1CC80923.png
panopea_1E04B901.pngpanopea_1E04B901.png 173KB Dec 16 2016 04:06:26 PMpanopea_1E04B901.png
Panopto_Recordings_1E687AD3.pngPanopto_Recordings_1E687AD3.png 261KB Mar 02 2017 08:07:48 AMPanopto_Recordings_1E687AD3.png
paper-pano-go_Male-v-Female-Expression_csv_at_master_·_sr320_paper-pano-go_1C8F1B19.pngpaper-pano-go_Male-v-Female-Expression_c... 43KB Mar 08 2016 06:37:12 AMpaper-pano-go_Male-v-Female-Expression_csv_at_master_·_sr320_paper-pano-go_1C8F1B19.png
paper-pano-go_manuscript_methods_at_master_·_sr320_paper-pano-go_1BE15DC6.pngpaper-pano-go_manuscript_methods_at_mast... 44KB Oct 28 2015 12:47:20 PMpaper-pano-go_manuscript_methods_at_master_·_sr320_paper-pano-go_1BE15DC6.png
Pathway_19958AF9.pngPathway_19958AF9.png 212KB Aug 08 2014 03:47:22 PMPathway_19958AF9.png
Pathway_19958BFB.pngPathway_19958BFB.png 151KB Aug 08 2014 03:51:40 PMPathway_19958BFB.png
Pathway_19958C38.pngPathway_19958C38.png 50KB Aug 08 2014 03:52:40 PMPathway_19958C38.png
Pathway_19958C75.pngPathway_19958C75.png 88KB Aug 08 2014 03:53:41 PMPathway_19958C75.png
Pathway_19958D06.pngPathway_19958D06.png 51KB Aug 08 2014 03:56:07 PMPathway_19958D06.png
Pathway_19958D46.pngPathway_19958D46.png 135KB Aug 08 2014 03:57:10 PMPathway_19958D46.png
Pathway_19958FA0.pngPathway_19958FA0.png 123KB Aug 08 2014 04:07:13 PMPathway_19958FA0.png
Pathway_19958FD7.pngPathway_19958FD7.png 95KB Aug 08 2014 04:08:08 PMPathway_19958FD7.png
Pathway_199586AB.pngPathway_199586AB.png 59KB Aug 08 2014 03:28:59 PMPathway_199586AB.png
Pathway_199586B4.pngPathway_199586B4.png 59KB Aug 08 2014 03:29:08 PMPathway_199586B4.png
Pathway_19959006.pngPathway_19959006.png 75KB Aug 08 2014 04:08:55 PMPathway_19959006.png
pc3_18A6AD70.pngpc3_18A6AD70.png 123KB Feb 08 2014 10:24:52 AMpc3_18A6AD70.png
PCR_-_YouTube_19E571F1.pngPCR_-_YouTube_19E571F1.png 192KB Oct 08 2014 06:21:54 AMPCR_-_YouTube_19E571F1.png
pcr_1AFD6978.pngpcr_1AFD6978.png 63KB May 08 2015 03:00:25 PMpcr_1AFD6978.png
phone_–_quarter-shell_–_Staging_for_my_Lab_Notebook_1D9DA9EE.pngphone_–_quarter-shell_–_Staging_for_... 94KB Sep 29 2016 12:58:39 PMphone_–_quarter-shell_–_Staging_for_my_Lab_Notebook_1D9DA9EE.png
Photos_-_Dropbox_17C6C3D1.pngPhotos_-_Dropbox_17C6C3D1.png 1043KB Aug 22 2013 03:18:12 PMPhotos_-_Dropbox_17C6C3D1.png
Photos_-_Google__184F84F8.pngPhotos_-_Google__184F84F8.png 947KB Dec 04 2013 07:42:49 AMPhotos_-_Google__184F84F8.png
Photo_-_Google_Photos_1BA8F73F.pngPhoto_-_Google_Photos_1BA8F73F.png 200KB Sep 15 2015 06:02:58 PMPhoto_-_Google_Photos_1BA8F73F.png
Photo_Station_6_183545FB.pngPhoto_Station_6_183545FB.png 995KB Nov 14 2013 09:55:48 AMPhoto_Station_6_183545FB.png
pH_Calculator__TRIS_AMP__1C712748.pngpH_Calculator__TRIS_AMP__1C712748.png 60KB Feb 14 2016 01:21:16 PMpH_Calculator__TRIS_AMP__1C712748.png
Pineapple_-_Untitled23_1C584BA1.pngPineapple_-_Untitled23_1C584BA1.png 19KB Jan 26 2016 04:49:39 PMPineapple_-_Untitled23_1C584BA1.png
PLOS_ONE__Development_of_Genomic_Resources_for_a_thraustochytrid_Pathogen_and_Investigation_of_Temperature_Influences_on_Gene_Expression_1BBEEEB4.pngPLOS_ONE__Development_of_Genomic_Resourc... 13KB Oct 02 2015 09:56:21 AMPLOS_ONE__Development_of_Genomic_Resources_for_a_thraustochytrid_Pathogen_and_Investigation_of_Temperature_Influences_on_Gene_Expression_1BBEEEB4.png
PLOS_ONE__Development_of_Genomic_Resources_for_a_thraustochytrid_Pathogen_and_Investigation_of_Temperature_Influences_on_Gene_Expression_1DECE5F5.pngPLOS_ONE__Development_of_Genomic_Resourc... 130KB Nov 28 2016 02:23:49 PMPLOS_ONE__Development_of_Genomic_Resources_for_a_thraustochytrid_Pathogen_and_Investigation_of_Temperature_Influences_on_Gene_Expression_1DECE5F5.png
PLOS_ONE__Development_of_Genomic_Resources_for_a_thraustochytrid_Pathogen_and_Investigation_of_Temperature_Influences_on_Gene_Expression_1DECE65C.pngPLOS_ONE__Development_of_Genomic_Resourc... 106KB Nov 28 2016 02:25:33 PMPLOS_ONE__Development_of_Genomic_Resources_for_a_thraustochytrid_Pathogen_and_Investigation_of_Temperature_Influences_on_Gene_Expression_1DECE65C.png
PLOS_ONE__Development_of_Genomic_Resources_for_a_thraustochytrid_Pathogen_and_Investigation_of_Temperature_Influences_on_Gene_Expression_1DECE588.pngPLOS_ONE__Development_of_Genomic_Resourc... 46KB Nov 28 2016 02:22:01 PMPLOS_ONE__Development_of_Genomic_Resources_for_a_thraustochytrid_Pathogen_and_Investigation_of_Temperature_Influences_on_Gene_Expression_1DECE588.png
PLOS_ONE__Development_of_Genomic_Resources_for_a_thraustochytrid_Pathogen_and_Investigation_of_Temperature_Influences_on_Gene_Expression_1DECE628.pngPLOS_ONE__Development_of_Genomic_Resourc... 93KB Nov 28 2016 02:24:41 PMPLOS_ONE__Development_of_Genomic_Resources_for_a_thraustochytrid_Pathogen_and_Investigation_of_Temperature_Influences_on_Gene_Expression_1DECE628.png
PLOS_ONE__Up_in_Arms__Immune_and_Nervous_System_Response_to_Sea_Star_Wasting_Disease_1BBEF78F.pngPLOS_ONE__Up_in_Arms__Immune_and_Nervous... 83KB Oct 02 2015 10:34:08 AMPLOS_ONE__Up_in_Arms__Immune_and_Nervous_System_Response_to_Sea_Star_Wasting_Disease_1BBEF78F.png
PLOS_ONE__Up_in_Arms__Immune_and_Nervous_System_Response_to_Sea_Star_Wasting_Disease_1BBEF736.pngPLOS_ONE__Up_in_Arms__Immune_and_Nervous... 71KB Oct 02 2015 10:32:39 AMPLOS_ONE__Up_in_Arms__Immune_and_Nervous_System_Response_to_Sea_Star_Wasting_Disease_1BBEF736.png
Polls___Poll_Everywhere_1E53B96D.pngPolls___Poll_Everywhere_1E53B96D.png 130KB Feb 14 2017 02:17:21 PMPolls___Poll_Everywhere_1E53B96D.png
Polymerase_chain_reaction_-_Wikipedia__the_free_encyclopedia_1AFD6951.pngPolymerase_chain_reaction_-_Wikipedia__t... 63KB May 08 2015 02:59:45 PMPolymerase_chain_reaction_-_Wikipedia__the_free_encyclopedia_1AFD6951.png
Polymerase_Chain_Reaction__PCR__-_YouTube_19E57279.pngPolymerase_Chain_Reaction__PCR__-_YouTub... 103KB Oct 08 2014 06:24:10 AMPolymerase_Chain_Reaction__PCR__-_YouTube_19E57279.png
Poster_SETAC_cdr_1DCD03E2.pngPoster_SETAC_cdr_1DCD03E2.png 1086KB Nov 04 2016 10:59:01 AMPoster_SETAC_cdr_1DCD03E2.png
PowerPoint_Slide_Show_-__AGA_Gavery_2014_poster_B_ppt__195B1C0F.pngPowerPoint_Slide_Show_-__AGA_Gavery_2014... 225KB Jun 25 2014 08:02:41 AMPowerPoint_Slide_Show_-__AGA_Gavery_2014_poster_B_ppt__195B1C0F.png
PREDICTED__Homo_sapiens_DNA__cytosine-5-_-methyltransferase_1__DNMT1___-_Nucleotide_-_NCBI_1BD976CD.pngPREDICTED__Homo_sapiens_DNA__cytosine-5-... 122KB Oct 22 2015 12:55:58 PMPREDICTED__Homo_sapiens_DNA__cytosine-5-_-methyltransferase_1__DNMT1___-_Nucleotide_-_NCBI_1BD976CD.png
Predominant_intragenic_methylation_is_associated_with_gene_expression_characteristics_in_a_bivalve_mollusc__PeerJ__1BBEECD9.pngPredominant_intragenic_methylation_is_as... 55KB Oct 02 2015 09:48:27 AMPredominant_intragenic_methylation_is_associated_with_gene_expression_characteristics_in_a_bivalve_mollusc__PeerJ__1BBEECD9.png
Predominant_intragenic_methylation_is_associated_with_gene_expression_characteristics_in_a_bivalve_mollusc__PeerJ__1BBEED09.pngPredominant_intragenic_methylation_is_as... 57KB Oct 02 2015 09:49:14 AMPredominant_intragenic_methylation_is_associated_with_gene_expression_characteristics_in_a_bivalve_mollusc__PeerJ__1BBEED09.png
Primer-Blast_results_1848AB36.pngPrimer-Blast_results_1848AB36.png 112KB Nov 29 2013 03:00:10 AMPrimer-Blast_results_1848AB36.png
Primer_designing_tool_1848AB1C.pngPrimer_designing_tool_1848AB1C.png 65KB Nov 29 2013 02:59:43 AMPrimer_designing_tool_1848AB1C.png
Printer_Software_and_Add__and_Printer_set-up__·_Issue__40_·_sr320_LabDocs_1A7AFCDE.pngPrinter_Software_and_Add__and_Printer_se... 105KB Jan 29 2015 03:42:23 PMPrinter_Software_and_Add__and_Printer_set-up__·_Issue__40_·_sr320_LabDocs_1A7AFCDE.png
Printer_Software_and_Add__and_Printer_set-up__·_Issue__40_·_sr320_LabDocs_1A7AFD03.pngPrinter_Software_and_Add__and_Printer_se... 104KB Jan 29 2015 03:43:00 PMPrinter_Software_and_Add__and_Printer_set-up__·_Issue__40_·_sr320_LabDocs_1A7AFD03.png
Printer_Software_and_Add__and_Printer_set-up__·_Issue__40_·_sr320_LabDocs_1A7AFD1A.pngPrinter_Software_and_Add__and_Printer_se... 104KB Jan 29 2015 03:43:22 PMPrinter_Software_and_Add__and_Printer_set-up__·_Issue__40_·_sr320_LabDocs_1A7AFD1A.png
Privacy_error_1EB7EA2A.pngPrivacy_error_1EB7EA2A.png 53KB May 01 2017 03:11:55 PMPrivacy_error_1EB7EA2A.png
Process-rad-TABS_and_data-genomic_and_git-repos_and_bash_-_What_is_a_unix_command_for_deleting_the_first_N_characters_of_a_line__-_Stack_Overflow_1A893A6C.pngProcess-rad-TABS_and_data-genomic_and_gi... 269KB Feb 09 2015 10:56:45 AMProcess-rad-TABS_and_data-genomic_and_git-repos_and_bash_-_What_is_a_unix_command_for_deleting_the_first_N_characters_of_a_line__-_Stack_Overflow_1A893A6C.png
project-olympia_oyster-genomic_contract_BGI_Olurida_denovo_F15FTSUSAT0327_pdf_at_master_·_RobertsLab_project-olympia_oyster-genomic_1DB64532.pngproject-olympia_oyster-genomic_contract_... 37KB Oct 18 2016 04:55:33 AMproject-olympia_oyster-genomic_contract_BGI_Olurida_denovo_F15FTSUSAT0327_pdf_at_master_·_RobertsLab_project-olympia_oyster-genomic_1DB64532.png
Project1_1A0940C4.pngProject1_1A0940C4.png 116KB Nov 04 2014 09:13:42 AMProject1_1A0940C4.png
project_juvenile_geoduck_OA_20161201_Library_prep_1_csv_at_master_·_hputnam_project_juvenile_geoduck_OA_1E3D5BCF.pngproject_juvenile_geoduck_OA_20161201_Lib... 103KB Jan 28 2017 03:08:01 PMproject_juvenile_geoduck_OA_20161201_Library_prep_1_csv_at_master_·_hputnam_project_juvenile_geoduck_OA_1E3D5BCF.png
Proteasome_-_YouTube_19D5ACC4.pngProteasome_-_YouTube_19D5ACC4.png 241KB Sep 26 2014 07:16:37 AMProteasome_-_YouTube_19D5ACC4.png
Proteins_for_BioSystems__Select_751435__-_Protein_-_NCBI_199D838B.pngProteins_for_BioSystems__Select_751435__... 96KB Aug 14 2014 04:53:49 PMProteins_for_BioSystems__Select_751435__-_Protein_-_NCBI_199D838B.png
PubMed_Central__Figure_1__Front_Physiol__2011__2__116__Published_online_2012_Jan_2__Prepublished_online_2011_Nov_30__doi_ _10_3389_fphys_2011_00116_1AA50E91.pngPubMed_Central__Figure_1__Front_Physiol_... 213KB Mar 02 2015 01:33:05 PMPubMed_Central__Figure_1__Front_Physiol__2011__2__116__Published_online_2012_Jan_2__Prepublished_online_2011_Nov_30__doi_ _10_3389_fphys_2011_00116_1AA50E91.png
PubMed_Central__Figure_1__Front_Physiol__2011__2__116__Published_online_2012_Jan_2__Prepublished_online_2011_Nov_30__doi_ _10_3389_fphys_2011_00116_1AA50ED9.pngPubMed_Central__Figure_1__Front_Physiol_... 213KB Mar 02 2015 01:34:17 PMPubMed_Central__Figure_1__Front_Physiol__2011__2__116__Published_online_2012_Jan_2__Prepublished_online_2011_Nov_30__doi_ _10_3389_fphys_2011_00116_1AA50ED9.png
Punch_card_·_MeganEDuffy_FISH-546_1E083027.pngPunch_card_·_MeganEDuffy_FISH-546_1E083... 53KB Dec 19 2016 07:11:37 AMPunch_card_·_MeganEDuffy_FISH-546_1E083027.png
pw_17E9F371.pngpw_17E9F371.png 122KB Sep 18 2013 07:42:58 AMpw_17E9F371.png
P_generosa_1E832EE5.pngP_generosa_1E832EE5.png 124KB Mar 22 2017 03:15:02 PMP_generosa_1E832EE5.png
P_generosa_1E832F05.pngP_generosa_1E832F05.png 124KB Mar 22 2017 03:15:34 PMP_generosa_1E832F05.png
QPX_clams_pdf__page_1_of_59__1985A03F.pngQPX_clams_pdf__page_1_of_59__1985A03F.png 590KB Jul 27 2014 02:01:58 PMQPX_clams_pdf__page_1_of_59__1985A03F.png
QPX_Genome_Browser_18022BB8.pngQPX_Genome_Browser_18022BB8.png 48KB Oct 06 2013 04:37:30 PMQPX_Genome_Browser_18022BB8.png
QPX_Genome_Browser_Feature_Tracks_1BBEF2DB.pngQPX_Genome_Browser_Feature_Tracks_1BBEF2... 235KB Oct 02 2015 10:14:06 AMQPX_Genome_Browser_Feature_Tracks_1BBEF2DB.png
quantitative_pcr_-_Google_Search_1B00E867.pngquantitative_pcr_-_Google_Search_1B00E86... 23KB May 11 2015 06:38:47 AMquantitative_pcr_-_Google_Search_1B00E867.png
quantitative_pcr_sybr_green_-_Google_Search_1B00E7D1.pngquantitative_pcr_sybr_green_-_Google_Sea... 37KB May 11 2015 06:36:17 AMquantitative_pcr_sybr_green_-_Google_Search_1B00E7D1.png
quarter-shell_–_Staging_for_my_Lab_Notebook_1D9DA786.pngquarter-shell_–_Staging_for_my_Lab_Not... 148KB Sep 29 2016 12:48:25 PMquarter-shell_–_Staging_for_my_Lab_Notebook_1D9DA786.png
Queries_tagged__qdod2_1A5B510A.pngQueries_tagged__qdod2_1A5B510A.png 96KB Jan 05 2015 03:08:59 PMQueries_tagged__qdod2_1A5B510A.png
RASC_Fellowship_-_roberts.sbr_gmail.com_-_Gmail_18511B3C.pngRASC_Fellowship_-_roberts.sbr_gmail.com_... 32KB Dec 05 2013 12:36:26 PMRASC_Fellowship_-_roberts.sbr_gmail.com_-_Gmail_18511B3C.png
README_1BA1FDD4.pngREADME_1BA1FDD4.png 95KB Sep 10 2015 11:05:09 AMREADME_1BA1FDD4.png
README_md_1A7C4FE1.pngREADME_md_1A7C4FE1.png 158KB Jan 30 2015 03:48:51 PMREADME_md_1A7C4FE1.png
readme_txt_1BF26FAF.pngreadme_txt_1BF26FAF.png 68KB Nov 10 2015 10:32:17 AMreadme_txt_1BF26FAF.png
ref_88_18A6AFBF.pngref_88_18A6AFBF.png 84KB Feb 08 2014 10:34:45 AMref_88_18A6AFBF.png
Release_Git_for_Windows_2_5_3_·_git-for-windows_git_·_GitHub_-_Google_Chrome_1BB99D99.pngRelease_Git_for_Windows_2_5_3_·_git-for... 179KB Sep 28 2015 09:08:58 AMRelease_Git_for_Windows_2_5_3_·_git-for-windows_git_·_GitHub_-_Google_Chrome_1BB99D99.png
Release_Git_for_Windows_2_5_3_·_git-for-windows_git_·_GitHub_-_Google_Chrome_1BB99DAD.pngRelease_Git_for_Windows_2_5_3_·_git-for... 181KB Sep 28 2015 09:09:17 AMRelease_Git_for_Windows_2_5_3_·_git-for-windows_git_·_GitHub_-_Google_Chrome_1BB99DAD.png
Resilience-Project_order112381-report_csv_at_master_·_jheare_Resilience-Project_1B38809D.pngResilience-Project_order112381-report_cs... 211KB Jun 22 2015 10:42:53 AMResilience-Project_order112381-report_csv_at_master_·_jheare_Resilience-Project_1B38809D.png
Resilience-Project_qPCR_data_at_master_·_jheare_Resilience-Project_1B91E568.pngResilience-Project_qPCR_data_at_master_... 76KB Aug 29 2015 06:04:40 AMResilience-Project_qPCR_data_at_master_·_jheare_Resilience-Project_1B91E568.png
Resilience-Project_qPCR_data_at_master_·_jheare_Resilience-Project_1B91E896.pngResilience-Project_qPCR_data_at_master_... 20KB Aug 29 2015 06:18:14 AMResilience-Project_qPCR_data_at_master_·_jheare_Resilience-Project_1B91E896.png
reviewed_yes_in_UniProtKB_1D8B14F0.pngreviewed_yes_in_UniProtKB_1D8B14F0.png 210KB Sep 15 2016 10:42:09 AMreviewed_yes_in_UniProtKB_1D8B14F0.png
reviewed_yes_in_UniProtKB_1D8B1632.pngreviewed_yes_in_UniProtKB_1D8B1632.png 97KB Sep 15 2016 10:47:31 AMreviewed_yes_in_UniProtKB_1D8B1632.png
reviewed_yes_in_UniProtKB_187B21D6.pngreviewed_yes_in_UniProtKB_187B21D6.png 200KB Jan 06 2014 09:39:35 AMreviewed_yes_in_UniProtKB_187B21D6.png
reviewed_yes_in_UniProtKB_and_notebooks__1D8B158F.pngreviewed_yes_in_UniProtKB_and_notebooks_... 31KB Sep 15 2016 10:44:47 AMreviewed_yes_in_UniProtKB_and_notebooks__1D8B158F.png
reviewed_yes_in_UniProtKB_and_notebooks__1D8B1604.pngreviewed_yes_in_UniProtKB_and_notebooks_... 34KB Sep 15 2016 10:46:45 AMreviewed_yes_in_UniProtKB_and_notebooks__1D8B1604.png
REVIGO_Output_1BDAEFE0.pngREVIGO_Output_1BDAEFE0.png 142KB Oct 23 2015 03:44:50 PMREVIGO_Output_1BDAEFE0.png
REVIGO_Output_1E7F2BF5.pngREVIGO_Output_1E7F2BF5.png 90KB Mar 19 2017 02:13:28 PMREVIGO_Output_1E7F2BF5.png
REVIGO_Output_1E7F2C64.pngREVIGO_Output_1E7F2C64.png 122KB Mar 19 2017 02:15:18 PMREVIGO_Output_1E7F2C64.png
REVIGO_Output_17CD16DA.pngREVIGO_Output_17CD16DA.png 94KB Aug 27 2013 10:26:19 AMREVIGO_Output_17CD16DA.png
REVIGO_Output_18A6B01E.pngREVIGO_Output_18A6B01E.png 117KB Feb 08 2014 10:36:20 AMREVIGO_Output_18A6B01E.png
REVIGO_Output_18A6B052.pngREVIGO_Output_18A6B052.png 52KB Feb 08 2014 10:37:12 AMREVIGO_Output_18A6B052.png
REVIGO_Output_18A6B2BA.pngREVIGO_Output_18A6B2BA.png 133KB Feb 08 2014 10:47:31 AMREVIGO_Output_18A6B2BA.png
REVIGO_Output_18EEE736.pngREVIGO_Output_18EEE736.png 124KB Apr 04 2014 06:12:25 AMREVIGO_Output_18EEE736.png
REVIGO_Output_199CF8DA.pngREVIGO_Output_199CF8DA.png 49KB Aug 14 2014 07:02:03 AMREVIGO_Output_199CF8DA.png
REVIGO_Output_199CFA0D.pngREVIGO_Output_199CFA0D.png 65KB Aug 14 2014 07:07:10 AMREVIGO_Output_199CFA0D.png
REVIGO_Output_199CFA5F.pngREVIGO_Output_199CFA5F.png 30KB Aug 14 2014 07:08:32 AMREVIGO_Output_199CFA5F.png
REVIGO_Output_18521FBB.pngREVIGO_Output_18521FBB.png 167KB Dec 06 2013 07:07:40 AMREVIGO_Output_18521FBB.png
REVIGO_Output_19959A7A.pngREVIGO_Output_19959A7A.png 106KB Aug 08 2014 04:53:31 PMREVIGO_Output_19959A7A.png
REVIGO_Output_19959A9F.pngREVIGO_Output_19959A9F.png 38KB Aug 08 2014 04:54:08 PMREVIGO_Output_19959A9F.png
REVIGO_Output_19959CEA.pngREVIGO_Output_19959CEA.png 112KB Aug 08 2014 05:03:55 PMREVIGO_Output_19959CEA.png
REVIGO_Output_1995977C.pngREVIGO_Output_1995977C.png 113KB Aug 08 2014 04:40:45 PMREVIGO_Output_1995977C.png
REVIGO_summarizes_and_visualizes_long_lists_of_Gene_Ontology_terms_19959715.pngREVIGO_summarizes_and_visualizes_long_li... 35KB Aug 08 2014 04:39:02 PMREVIGO_summarizes_and_visualizes_long_lists_of_Gene_Ontology_terms_19959715.png
revigo_treemap.pdf__1_page__17E0FC3B.pngrevigo_treemap.pdf__1_page__17E0FC3B.png 171KB Sep 11 2013 12:30:08 PMrevigo_treemap.pdf__1_page__17E0FC3B.png
Revisions_-_roberts_sbr_gmail_com_-_Gmail_1A7C087A.pngRevisions_-_roberts_sbr_gmail_com_-_Gmai... 27KB Jan 30 2015 10:44:11 AMRevisions_-_roberts_sbr_gmail_com_-_Gmail_1A7C087A.png
rev_1E0851F8.pngrev_1E0851F8.png 227KB Dec 19 2016 09:35:53 AMrev_1E0851F8.png
Re__Call_for_Projects_-_Oyster_Workshops_-_roberts_sbr_gmail_com_-_Gmail_19C22E9A.pngRe__Call_for_Projects_-_Oyster_Workshops... 209KB Sep 11 2014 12:25:15 PMRe__Call_for_Projects_-_Oyster_Workshops_-_roberts_sbr_gmail_com_-_Gmail_19C22E9A.png
RNA-Seq_Analysis_1A438E8A.pngRNA-Seq_Analysis_1A438E8A.png 41KB Dec 18 2014 02:37:00 PMRNA-Seq_Analysis_1A438E8A.png
RNA-Seq_Analysis_17CE61C7.pngRNA-Seq_Analysis_17CE61C7.png 29KB Aug 28 2013 09:58:21 AMRNA-Seq_Analysis_17CE61C7.png
RNA-Seq_Analysis_17E25F01.pngRNA-Seq_Analysis_17E25F01.png 29KB Sep 12 2013 01:43:48 PMRNA-Seq_Analysis_17E25F01.png
RNA-Seq_Analysis_1819BEA7.pngRNA-Seq_Analysis_1819BEA7.png 20KB Oct 24 2013 01:46:46 PMRNA-Seq_Analysis_1819BEA7.png
RNA-Seq_in_Mytilus_galloprovincialis__comparative_transcriptomics_and_expression_profiles_among_different_tissues_1D872550.pngRNA-Seq_in_Mytilus_galloprovincialis__co... 106KB Sep 12 2016 11:03:09 AMRNA-Seq_in_Mytilus_galloprovincialis__comparative_transcriptomics_and_expression_profiles_among_different_tissues_1D872550.png
RNA-Seq_tutorial_-_Education__Outreach__and_Training_-_iPlant_Collaborative_Wiki_1A45D493.pngRNA-Seq_tutorial_-_Education__Outreach__... 27KB Dec 20 2014 08:00:20 AMRNA-Seq_tutorial_-_Education__Outreach__and_Training_-_iPlant_Collaborative_Wiki_1A45D493.png
RNA-Seq___The_Istrail_Laboratory_of_Brown_University_and_Text_S1_1A8BCBAD.pngRNA-Seq___The_Istrail_Laboratory_of_Brow... 668KB Feb 11 2015 09:41:01 AMRNA-Seq___The_Istrail_Laboratory_of_Brown_University_and_Text_S1_1A8BCBAD.png
RNA-Seq___The_Istrail_Laboratory_of_Brown_University_and_Text_S1_1A8BCBBD.pngRNA-Seq___The_Istrail_Laboratory_of_Brow... 668KB Feb 11 2015 09:41:17 AMRNA-Seq___The_Istrail_Laboratory_of_Brown_University_and_Text_S1_1A8BCBBD.png
Roberts_Lab_-_Community_-_Google__1A155160.pngRoberts_Lab_-_Community_-_Google__1A1551... 154KB Nov 13 2014 12:51:45 PMRoberts_Lab_-_Community_-_Google__1A155160.png
Roberts_Lab_-_Community_-_Google__18688934.pngRoberts_Lab_-_Community_-_Google__186889... 218KB Dec 23 2013 07:07:44 AMRoberts_Lab_-_Community_-_Google__18688934.png
Roberts_Lab_-_Seattle__WA_-_Community___Facebook_185A48AE.pngRoberts_Lab_-_Seattle__WA_-_Community___... 438KB Dec 12 2013 11:40:32 AMRoberts_Lab_-_Seattle__WA_-_Community___Facebook_185A48AE.png
Roberts_Lab___School_of_Aquatic_and_Fishery_Sciences___University_of_Washington_19E99018.pngRoberts_Lab___School_of_Aquatic_and_Fish... 128KB Oct 11 2014 09:19:36 AMRoberts_Lab___School_of_Aquatic_and_Fishery_Sciences___University_of_Washington_19E99018.png
Roberts_NSF_Beacon.pdf_-_Google_Drive_17B17566.pngRoberts_NSF_Beacon.pdf_-_Google_Drive_17... 55KB Aug 06 2013 11:25:09 AMRoberts_NSF_Beacon.pdf_-_Google_Drive_17B17566.png
Rplot_tiff_1DC2564D.pngRplot_tiff_1DC2564D.png 229KB Oct 27 2016 08:35:42 AMRplot_tiff_1DC2564D.png
RStudio_1A36862A.pngRStudio_1A36862A.png 27KB Dec 08 2014 05:21:48 PMRStudio_1A36862A.png
RStudio_1C5A4CE7.pngRStudio_1C5A4CE7.png 21KB Jan 28 2016 05:19:36 AMRStudio_1C5A4CE7.png
RStudio_1C5A4D15.pngRStudio_1C5A4D15.png 24KB Jan 28 2016 05:20:22 AMRStudio_1C5A4D15.png
RStudio_1C567FED.pngRStudio_1C567FED.png 18KB Jan 25 2016 08:08:15 AMRStudio_1C567FED.png
RStudio_1C568872.pngRStudio_1C568872.png 21KB Jan 25 2016 08:44:37 AMRStudio_1C568872.png
RStudio_1CB41F9C.pngRStudio_1CB41F9C.png 19KB Apr 05 2016 09:30:21 AMRStudio_1CB41F9C.png
RStudio_1CB41F50.pngRStudio_1CB41F50.png 29KB Apr 05 2016 09:29:05 AMRStudio_1CB41F50.png
RStudio_1CB421EC.pngRStudio_1CB421EC.png 23KB Apr 05 2016 09:40:15 AMRStudio_1CB421EC.png
RStudio_1CBDBD3A.pngRStudio_1CBDBD3A.png 52KB Apr 12 2016 04:33:17 PMRStudio_1CBDBD3A.png
RStudio_1CBEB1F3.pngRStudio_1CBEB1F3.png 32KB Apr 13 2016 09:57:25 AMRStudio_1CBEB1F3.png
RStudio_1CBEB3E6.pngRStudio_1CBEB3E6.png 27KB Apr 13 2016 10:05:43 AMRStudio_1CBEB3E6.png
RStudio_1CBEB4F7.pngRStudio_1CBEB4F7.png 52KB Apr 13 2016 10:10:16 AMRStudio_1CBEB4F7.png
RStudio_1CBEB237.pngRStudio_1CBEB237.png 29KB Apr 13 2016 09:58:31 AMRStudio_1CBEB237.png
RStudio_1CC19CD5.pngRStudio_1CC19CD5.png 52KB Apr 15 2016 03:04:06 PMRStudio_1CC19CD5.png
RStudio_1CC19CEC.pngRStudio_1CC19CEC.png 52KB Apr 15 2016 03:04:28 PMRStudio_1CC19CEC.png
RStudio_1D11F97D.pngRStudio_1D11F97D.png 80KB Jun 15 2016 02:00:47 PMRStudio_1D11F97D.png
RStudio_1D11FA76.pngRStudio_1D11FA76.png 73KB Jun 15 2016 02:04:55 PMRStudio_1D11FA76.png
RStudio_1D11FBB0.pngRStudio_1D11FBB0.png 88KB Jun 15 2016 02:10:08 PMRStudio_1D11FBB0.png
RStudio_1E7C7809.pngRStudio_1E7C7809.png 33KB Mar 17 2017 01:01:15 PMRStudio_1E7C7809.png
RStudio_1E82C951.pngRStudio_1E82C951.png 29KB Mar 22 2017 08:01:37 AMRStudio_1E82C951.png
Run_Query_1A61D5FA.pngRun_Query_1A61D5FA.png 91KB Jan 10 2015 01:49:47 PMRun_Query_1A61D5FA.png
Run_Query_1BDA56B6.pngRun_Query_1BDA56B6.png 102KB Oct 23 2015 04:51:23 AMRun_Query_1BDA56B6.png
Run_Query_1BDA5820.pngRun_Query_1BDA5820.png 95KB Oct 23 2015 04:57:23 AMRun_Query_1BDA5820.png
Run_Query_1BDBB52D.pngRun_Query_1BDBB52D.png 70KB Oct 24 2015 05:46:40 AMRun_Query_1BDBB52D.png
Run_Query_1BF631AD.pngRun_Query_1BF631AD.png 48KB Nov 13 2015 06:56:45 AMRun_Query_1BF631AD.png
Run_Query_1BF63191.pngRun_Query_1BF63191.png 48KB Nov 13 2015 06:56:18 AMRun_Query_1BF63191.png
Run_Query_17CEA78C.pngRun_Query_17CEA78C.png 184KB Aug 28 2013 02:56:04 PMRun_Query_17CEA78C.png
Run_Query_187B1B37.pngRun_Query_187B1B37.png 134KB Jan 06 2014 09:11:20 AMRun_Query_187B1B37.png
Run_Query_187B1988.pngRun_Query_187B1988.png 102KB Jan 06 2014 09:04:09 AMRun_Query_187B1988.png
Run_Query_189AB9F3.pngRun_Query_189AB9F3.png 232KB Jan 30 2014 08:50:33 AMRun_Query_189AB9F3.png
Run_Query_1805EC9E.pngRun_Query_1805EC9E.png 20KB Oct 09 2013 12:57:20 PMRun_Query_1805EC9E.png
Run_Query_1805ED3F.pngRun_Query_1805ED3F.png 19KB Oct 09 2013 01:00:00 PMRun_Query_1805ED3F.png
Run_Query_1805ED9A.pngRun_Query_1805ED9A.png 16KB Oct 09 2013 01:01:31 PMRun_Query_1805ED9A.png
Run_Query_1808E6B2.pngRun_Query_1808E6B2.png 39KB Oct 11 2013 07:08:49 PMRun_Query_1808E6B2.png
Run_Query_1992E3DB.pngRun_Query_1992E3DB.png 58KB Aug 06 2014 03:29:48 PMRun_Query_1992E3DB.png
Run_Query_192284C8.pngRun_Query_192284C8.png 40KB May 13 2014 09:50:17 AMRun_Query_192284C8.png
Run_Query_192285CA.pngRun_Query_192285CA.png 39KB May 13 2014 09:54:34 AMRun_Query_192285CA.png
Run_Query_1922992D.pngRun_Query_1922992D.png 14KB May 13 2014 11:17:18 AMRun_Query_1922992D.png
Salmo_salar__ID_369__-_Genome_-_NCBI_1DBAFD9C.pngSalmo_salar__ID_369__-_Genome_-_NCBI_1DB... 25KB Oct 21 2016 06:51:25 PMSalmo_salar__ID_369__-_Genome_-_NCBI_1DBAFD9C.png
Salmo_salar__ID_369__-_Genome_-_NCBI_and_journal_pone_0165231_g007_PNG_1DBAFCF6.pngSalmo_salar__ID_369__-_Genome_-_NCBI_and... 269KB Oct 21 2016 06:48:43 PMSalmo_salar__ID_369__-_Genome_-_NCBI_and_journal_pone_0165231_g007_PNG_1DBAFCF6.png
Samples_of_Yanouk_-_roberts_sbr_gmail_com_-_Gmail_18C7D582.pngSamples_of_Yanouk_-_roberts_sbr_gmail_co... 15KB Mar 05 2014 01:58:30 PMSamples_of_Yanouk_-_roberts_sbr_gmail_com_-_Gmail_18C7D582.png
sam_1B6521EA.pngsam_1B6521EA.png 574KB Jul 26 2015 07:11:36 AMsam_1B6521EA.png
sam_1B652232.pngsam_1B652232.png 574KB Jul 26 2015 07:12:04 AMsam_1B652232.png
Sam_s_Notebook___University_of_Washington_–_Fishery_Sciences_–_Roberts_Lab_1B18F153.pngSam_s_Notebook___University_of_Washingto... 120KB May 29 2015 12:11:15 PMSam_s_Notebook___University_of_Washington_–_Fishery_Sciences_–_Roberts_Lab_1B18F153.png
Sam_White_-_Google__19E85E47.pngSam_White_-_Google__19E85E47.png 620KB Oct 10 2014 11:34:48 AMSam_White_-_Google__19E85E47.png
Sam_White_-_Google__19E82529.pngSam_White_-_Google__19E82529.png 533KB Oct 10 2014 07:31:07 AMSam_White_-_Google__19E82529.png
Save_and_Ahya_GOSlim_sorted_1A8E915D.pngSave_and_Ahya_GOSlim_sorted_1A8E915D.png 26KB Feb 13 2015 12:09:01 PMSave_and_Ahya_GOSlim_sorted_1A8E915D.png
ScholarOne_Manuscripts_1B288C8A.pngScholarOne_Manuscripts_1B288C8A.png 31KB Jun 10 2015 08:17:31 AMScholarOne_Manuscripts_1B288C8A.png
Screenshot_1_22_15__1_47_PM_1A716142.pngScreenshot_1_22_15__1_47_PM_1A716142.png 95KB Jan 22 2015 08:48:07 AMScreenshot_1_22_15__1_47_PM_1A716142.png
Screenshot_2_11_14_9_00_AM_18AA8EAD.pngScreenshot_2_11_14_9_00_AM_18AA8EAD.png 52KB Feb 11 2014 09:00:31 AMScreenshot_2_11_14_9_00_AM_18AA8EAD.png
Screenshot_2_20_15__11_45_AM_1A97C672.pngScreenshot_2_20_15__11_45_AM_1A97C672.png 54KB Feb 20 2015 11:45:54 AMScreenshot_2_20_15__11_45_AM_1A97C672.png
Screenshot_3_13_15__9_20_AM_1AB34D8C.pngScreenshot_3_13_15__9_20_AM_1AB34D8C.png 264KB Mar 13 2015 09:53:33 AMScreenshot_3_13_15__9_20_AM_1AB34D8C.png
Screenshot_3_13_17__1_56_PM_1E773F14.pngScreenshot_3_13_17__1_56_PM_1E773F14.png 230KB Mar 13 2017 01:56:53 PMScreenshot_3_13_17__1_56_PM_1E773F14.png
Screenshot_3_17_17__10_23_AM_1E7C5314.pngScreenshot_3_17_17__10_23_AM_1E7C5314.png 864KB Mar 17 2017 10:23:38 AMScreenshot_3_17_17__10_23_AM_1E7C5314.png
Screenshot_3_17_17__11_29_AM_1E7C627A.pngScreenshot_3_17_17__11_29_AM_1E7C627A.png 141KB Mar 17 2017 11:29:15 AMScreenshot_3_17_17__11_29_AM_1E7C627A.png
Screenshot_3_17_17__12_31_PM_1E7C7116.pngScreenshot_3_17_17__12_31_PM_1E7C7116.png 183KB Mar 17 2017 12:31:36 PMScreenshot_3_17_17__12_31_PM_1E7C7116.png
Screenshot_4_3_15__7_12_AM_1ACED741.pngScreenshot_4_3_15__7_12_AM_1ACED741.png 24KB Apr 03 2015 07:12:18 AMScreenshot_4_3_15__7_12_AM_1ACED741.png
Screenshot_4_3_15__7_22_AM_1ACED994.pngScreenshot_4_3_15__7_22_AM_1ACED994.png 37KB Apr 03 2015 07:22:12 AMScreenshot_4_3_15__7_22_AM_1ACED994.png
Screenshot_4_3_15__7_23_AM_1ACED9DD.pngScreenshot_4_3_15__7_23_AM_1ACED9DD.png 31KB Apr 03 2015 07:23:26 AMScreenshot_4_3_15__7_23_AM_1ACED9DD.png
Screenshot_4_3_15__7_28_AM_1ACEDB27.pngScreenshot_4_3_15__7_28_AM_1ACEDB27.png 34KB Apr 03 2015 07:28:56 AMScreenshot_4_3_15__7_28_AM_1ACEDB27.png
Screenshot_4_3_15__7_42_AM_1ACEDE69.pngScreenshot_4_3_15__7_42_AM_1ACEDE69.png 30KB Apr 03 2015 07:42:50 AMScreenshot_4_3_15__7_42_AM_1ACEDE69.png
Screenshot_4_3_15__7_48_AM_1ACEDFD9.pngScreenshot_4_3_15__7_48_AM_1ACEDFD9.png 28KB Apr 03 2015 07:48:57 AMScreenshot_4_3_15__7_48_AM_1ACEDFD9.png
Screenshot_4_3_15__8_07_AM_1ACEE43B.pngScreenshot_4_3_15__8_07_AM_1ACEE43B.png 149KB Apr 03 2015 08:07:39 AMScreenshot_4_3_15__8_07_AM_1ACEE43B.png
Screenshot_4_3_15__8_07_AM_1ACEE442.pngScreenshot_4_3_15__8_07_AM_1ACEE442.png 149KB Apr 03 2015 08:07:46 AMScreenshot_4_3_15__8_07_AM_1ACEE442.png
Screenshot_4_3_15__8_52_AM_1ACEEED5.pngScreenshot_4_3_15__8_52_AM_1ACEEED5.png 39KB Apr 03 2015 08:52:54 AMScreenshot_4_3_15__8_52_AM_1ACEEED5.png
Screenshot_4_3_15__8_54_AM_1ACEEF2F.pngScreenshot_4_3_15__8_54_AM_1ACEEF2F.png 63KB Apr 03 2015 08:54:24 AMScreenshot_4_3_15__8_54_AM_1ACEEF2F.png
Screenshot_4_3_17__8_52_AM_1E92A73C.pngScreenshot_4_3_17__8_52_AM_1E92A73C.png 62KB Apr 03 2017 08:52:30 AMScreenshot_4_3_17__8_52_AM_1E92A73C.png
Screenshot_4_4_14_8_51_AM_18EF0C86.pngScreenshot_4_4_14_8_51_AM_18EF0C86.png 344KB Apr 04 2014 08:51:35 AMScreenshot_4_4_14_8_51_AM_18EF0C86.png
Screenshot_4_6_15__8_15_AM_1AD2DAAA.pngScreenshot_4_6_15__8_15_AM_1AD2DAAA.png 289KB Apr 06 2015 08:15:55 AMScreenshot_4_6_15__8_15_AM_1AD2DAAA.png
Screenshot_4_17_17__1_21_PM_1EA55B51.pngScreenshot_4_17_17__1_21_PM_1EA55B51.png 241KB Apr 17 2017 01:21:39 PMScreenshot_4_17_17__1_21_PM_1EA55B51.png
Screenshot_4_18_17__8_31_AM_1EA668E0.pngScreenshot_4_18_17__8_31_AM_1EA668E0.png 272KB Apr 18 2017 08:31:46 AMScreenshot_4_18_17__8_31_AM_1EA668E0.png
Screenshot_4_20_16__1_21_PM_1CC81C4E.pngScreenshot_4_20_16__1_21_PM_1CC81C4E.png 25KB Apr 20 2016 01:21:36 PMScreenshot_4_20_16__1_21_PM_1CC81C4E.png
Screenshot_4_20_16__1_22_PM_1CC81C6F.pngScreenshot_4_20_16__1_22_PM_1CC81C6F.png 28KB Apr 20 2016 01:22:08 PMScreenshot_4_20_16__1_22_PM_1CC81C6F.png
Screenshot_4_20_16__11_59_AM_1CC808FE.pngScreenshot_4_20_16__11_59_AM_1CC808FE.png 91KB Apr 20 2016 11:59:11 AMScreenshot_4_20_16__11_59_AM_1CC808FE.png
Screenshot_4_20_16__12_10_PM_1CC80BB2.pngScreenshot_4_20_16__12_10_PM_1CC80BB2.png 322KB Apr 20 2016 12:10:44 PMScreenshot_4_20_16__12_10_PM_1CC80BB2.png
Screenshot_4_20_16__12_10_PM_1CC80BC5.pngScreenshot_4_20_16__12_10_PM_1CC80BC5.png 323KB Apr 20 2016 12:11:02 PMScreenshot_4_20_16__12_10_PM_1CC80BC5.png
Screenshot_4_20_16__12_28_PM_1CC80FC5.pngScreenshot_4_20_16__12_28_PM_1CC80FC5.png 144KB Apr 20 2016 12:28:07 PMScreenshot_4_20_16__12_28_PM_1CC80FC5.png
Screenshot_4_20_16__12_40_PM_1CC812BC.pngScreenshot_4_20_16__12_40_PM_1CC812BC.png 27KB Apr 20 2016 12:40:45 PMScreenshot_4_20_16__12_40_PM_1CC812BC.png
Screenshot_4_29_15__11_05_AM_1AF154E6.pngScreenshot_4_29_15__11_05_AM_1AF154E6.png 46KB Apr 29 2015 11:05:27 AMScreenshot_4_29_15__11_05_AM_1AF154E6.png
Screenshot_4_29_15__11_08_AM_1AF1558D.pngScreenshot_4_29_15__11_08_AM_1AF1558D.png 133KB Apr 29 2015 11:08:14 AMScreenshot_4_29_15__11_08_AM_1AF1558D.png
Screenshot_5_14_14_7_54_AM_1923BB2C.pngScreenshot_5_14_14_7_54_AM_1923BB2C.png 75KB May 14 2014 07:54:38 AMScreenshot_5_14_14_7_54_AM_1923BB2C.png
Screenshot_6_3_15__10_19_AM_1B1F6EB6.pngScreenshot_6_3_15__10_19_AM_1B1F6EB6.png 312KB Jun 03 2015 10:19:51 AMScreenshot_6_3_15__10_19_AM_1B1F6EB6.png
Screenshot_6_12_15__10_22_AM_1B2B4CF5.pngScreenshot_6_12_15__10_22_AM_1B2B4CF5.png 46KB Jun 12 2015 10:23:01 AMScreenshot_6_12_15__10_22_AM_1B2B4CF5.png
Screenshot_6_23_14_8_08_AM_19587A90.pngScreenshot_6_23_14_8_08_AM_19587A90.png 78KB Jun 23 2014 08:09:07 AMScreenshot_6_23_14_8_08_AM_19587A90.png
Screenshot_7_2_15__5_37_AM_1B456805.pngScreenshot_7_2_15__5_37_AM_1B456805.png 37KB Jul 02 2015 05:37:25 AMScreenshot_7_2_15__5_37_AM_1B456805.png
Screenshot_7_3_13_7_22_AM.png__1103×753__182D2440.pngScreenshot_7_3_13_7_22_AM.png__1103×753... 240KB Nov 08 2013 05:53:11 AMScreenshot_7_3_13_7_22_AM.png__1103×753__182D2440.png
Screenshot_7_3_13_7_22_AM.png__1103×753__18761B72.pngScreenshot_7_3_13_7_22_AM.png__1103×753... 134KB Jan 02 2014 02:11:00 PMScreenshot_7_3_13_7_22_AM.png__1103×753__18761B72.png
Screenshot_7_3_14_7_51_AM_1965A55E.pngScreenshot_7_3_14_7_51_AM_1965A55E.png 82KB Jul 03 2014 07:51:11 AMScreenshot_7_3_14_7_51_AM_1965A55E.png
Screenshot_7_3_14_8_19_AM_1965AC0E.pngScreenshot_7_3_14_8_19_AM_1965AC0E.png 91KB Jul 03 2014 08:19:43 AMScreenshot_7_3_14_8_19_AM_1965AC0E.png
Screenshot_7_3_14_8_19_AM_1965AC06.pngScreenshot_7_3_14_8_19_AM_1965AC06.png 91KB Jul 03 2014 08:19:35 AMScreenshot_7_3_14_8_19_AM_1965AC06.png
Screenshot_7_3_14_8_36_AM_1965B00B.pngScreenshot_7_3_14_8_36_AM_1965B00B.png 107KB Jul 03 2014 08:36:44 AMScreenshot_7_3_14_8_36_AM_1965B00B.png
Screenshot_7_7_14__12_30_PM_196B2CE2.pngScreenshot_7_7_14__12_30_PM_196B2CE2.png 91KB Jul 07 2014 12:30:43 PMScreenshot_7_7_14__12_30_PM_196B2CE2.png
Screenshot_7_9_15__2_26_PM_1B4F1E84.pngScreenshot_7_9_15__2_26_PM_1B4F1E84.png 393KB Jul 09 2015 02:26:19 PMScreenshot_7_9_15__2_26_PM_1B4F1E84.png
Screenshot_7_9_15__2_38_PM_1B4F216F.pngScreenshot_7_9_15__2_38_PM_1B4F216F.png 408KB Jul 09 2015 02:38:46 PMScreenshot_7_9_15__2_38_PM_1B4F216F.png
Screenshot_7_9_15__11_15_AM_1B4EF5A5.pngScreenshot_7_9_15__11_15_AM_1B4EF5A5.png 16KB Jul 09 2015 11:31:56 AMScreenshot_7_9_15__11_15_AM_1B4EF5A5.png
Screenshot_7_17_14__5_49_AM_1977FDE4.pngScreenshot_7_17_14__5_49_AM_1977FDE4.png 73KB Jul 17 2014 05:49:40 AMScreenshot_7_17_14__5_49_AM_1977FDE4.png
Screenshot_7_21_14_8_43_AM_197D6CB4.pngScreenshot_7_21_14_8_43_AM_197D6CB4.png 77KB Jul 21 2014 08:43:49 AMScreenshot_7_21_14_8_43_AM_197D6CB4.png
Screenshot_7_21_14_8_52_AM_197D6F5C.pngScreenshot_7_21_14_8_52_AM_197D6F5C.png 82KB Jul 21 2014 08:55:09 AMScreenshot_7_21_14_8_52_AM_197D6F5C.png
Screenshot_7_22_13_3_31_PM_179DEEE1.pngScreenshot_7_22_13_3_31_PM_179DEEE1.png 61KB Jul 22 2013 03:57:21 PMScreenshot_7_22_13_3_31_PM_179DEEE1.png
Screenshot_7_22_13_3_31_PM_179DEF5E.pngScreenshot_7_22_13_3_31_PM_179DEF5E.png 61KB Jul 22 2013 03:59:27 PMScreenshot_7_22_13_3_31_PM_179DEF5E.png
Screenshot_7_25_13_6_42_PM_17A20B98.pngScreenshot_7_25_13_6_42_PM_17A20B98.png 100KB Jul 25 2013 06:49:07 PMScreenshot_7_25_13_6_42_PM_17A20B98.png
Screenshot_7_25_14__3_12_PM_19830DD6.pngScreenshot_7_25_14__3_12_PM_19830DD6.png 78KB Jul 25 2014 03:12:40 PMScreenshot_7_25_14__3_12_PM_19830DD6.png
Screenshot_7_26_13_2_54_PM_17A327A5.pngScreenshot_7_26_13_2_54_PM_17A327A5.png 250KB Jul 26 2013 03:01:06 PMScreenshot_7_26_13_2_54_PM_17A327A5.png
Screenshot_7_26_13_6_53_AM_17A2B6D8.pngScreenshot_7_26_13_6_53_AM_17A2B6D8.png 148KB Jul 26 2013 06:59:46 AMScreenshot_7_26_13_6_53_AM_17A2B6D8.png
Screenshot_7_28_14__9_09_AM_1986AD44.pngScreenshot_7_28_14__9_09_AM_1986AD44.png 135KB Jul 28 2014 09:09:39 AMScreenshot_7_28_14__9_09_AM_1986AD44.png
Screenshot_8_8_13_8_48_AM_17B3F561.pngScreenshot_8_8_13_8_48_AM_17B3F561.png 135KB Aug 08 2013 08:55:54 AMScreenshot_8_8_13_8_48_AM_17B3F561.png
Screenshot_8_8_14__4_56_PM_19959B21.pngScreenshot_8_8_14__4_56_PM_19959B21.png 13KB Aug 08 2014 04:56:18 PMScreenshot_8_8_14__4_56_PM_19959B21.png
Screenshot_8_9_15__1_51_PM_1B77F561.pngScreenshot_8_9_15__1_51_PM_1B77F561.png 261KB Aug 09 2015 01:54:58 PMScreenshot_8_9_15__1_51_PM_1B77F561.png
Screenshot_8_17_13_8_40_AM_17BFD0E5.pngScreenshot_8_17_13_8_40_AM_17BFD0E5.png 134KB Aug 17 2013 08:47:48 AMScreenshot_8_17_13_8_40_AM_17BFD0E5.png
Screenshot_8_17_15__3_55_PM_1B8273B6.pngScreenshot_8_17_15__3_55_PM_1B8273B6.png 53KB Aug 17 2015 12:55:36 PMScreenshot_8_17_15__3_55_PM_1B8273B6.png
Screenshot_8_17_15__3_57_PM_1B827441.pngScreenshot_8_17_15__3_57_PM_1B827441.png 62KB Aug 17 2015 12:57:55 PMScreenshot_8_17_15__3_57_PM_1B827441.png
Screenshot_8_17_15__4_11_PM_1B8277A0.pngScreenshot_8_17_15__4_11_PM_1B8277A0.png 48KB Aug 17 2015 01:12:20 PMScreenshot_8_17_15__4_11_PM_1B8277A0.png
Screenshot_8_17_15__4_18_PM_1B827900.pngScreenshot_8_17_15__4_18_PM_1B827900.png 74KB Aug 17 2015 01:18:11 PMScreenshot_8_17_15__4_18_PM_1B827900.png
Screenshot_8_17_15__4_25_PM_1B827AA2.pngScreenshot_8_17_15__4_25_PM_1B827AA2.png 70KB Aug 17 2015 01:25:12 PMScreenshot_8_17_15__4_25_PM_1B827AA2.png
Screenshot_8_17_15__9_53_AM_1B821ECC.pngScreenshot_8_17_15__9_53_AM_1B821ECC.png 195KB Aug 17 2015 06:53:15 AMScreenshot_8_17_15__9_53_AM_1B821ECC.png
Screenshot_8_17_15__10_15_AM_1B822404.pngScreenshot_8_17_15__10_15_AM_1B822404.png 149KB Aug 17 2015 07:15:31 AMScreenshot_8_17_15__10_15_AM_1B822404.png
Screenshot_8_17_15__11_03_AM_1B822F48.pngScreenshot_8_17_15__11_03_AM_1B822F48.png 25KB Aug 17 2015 08:03:32 AMScreenshot_8_17_15__11_03_AM_1B822F48.png
Screenshot_8_17_15__11_10_AM_1B8230E7.pngScreenshot_8_17_15__11_10_AM_1B8230E7.png 101KB Aug 17 2015 08:10:28 AMScreenshot_8_17_15__11_10_AM_1B8230E7.png
Screenshot_8_17_15__11_16_AM_1B82325E.pngScreenshot_8_17_15__11_16_AM_1B82325E.png 89KB Aug 17 2015 08:16:43 AMScreenshot_8_17_15__11_16_AM_1B82325E.png
Screenshot_8_17_15__11_17_AM_1B82327D.pngScreenshot_8_17_15__11_17_AM_1B82327D.png 103KB Aug 17 2015 08:17:14 AMScreenshot_8_17_15__11_17_AM_1B82327D.png
Screenshot_8_17_15__11_24_AM_1B82344E.pngScreenshot_8_17_15__11_24_AM_1B82344E.png 23KB Aug 17 2015 08:25:00 AMScreenshot_8_17_15__11_24_AM_1B82344E.png
Screenshot_8_28_13_7_02_PM_17CEE388.pngScreenshot_8_28_13_7_02_PM_17CEE388.png 69KB Aug 28 2013 07:11:56 PMScreenshot_8_28_13_7_02_PM_17CEE388.png
Screenshot_8_29_15__6_14_AM_1B91E7B1.pngScreenshot_8_29_15__6_14_AM_1B91E7B1.png 57KB Aug 29 2015 06:14:26 AMScreenshot_8_29_15__6_14_AM_1B91E7B1.png
Screenshot_8_29_15__6_28_AM_1B91EB21.pngScreenshot_8_29_15__6_28_AM_1B91EB21.png 77KB Aug 29 2015 06:29:07 AMScreenshot_8_29_15__6_28_AM_1B91EB21.png
Screenshot_8_29_15__6_32_AM_1B91EBFF.pngScreenshot_8_29_15__6_32_AM_1B91EBFF.png 40KB Aug 29 2015 06:32:47 AMScreenshot_8_29_15__6_32_AM_1B91EBFF.png
Screenshot_8_29_15__6_40_AM_1B91EDBE.pngScreenshot_8_29_15__6_40_AM_1B91EDBE.png 104KB Aug 29 2015 06:40:15 AMScreenshot_8_29_15__6_40_AM_1B91EDBE.png
Screenshot_8_29_15__6_46_AM_1B91EF43.pngScreenshot_8_29_15__6_46_AM_1B91EF43.png 54KB Aug 29 2015 06:46:43 AMScreenshot_8_29_15__6_46_AM_1B91EF43.png
Screenshot_9_6_16__11_37_AM_1D7F4467.pngScreenshot_9_6_16__11_37_AM_1D7F4467.png 1587KB Sep 06 2016 11:37:31 AMScreenshot_9_6_16__11_37_AM_1D7F4467.png
Screenshot_9_13_13_7_30_AM_17E3598F.pngScreenshot_9_13_13_7_30_AM_17E3598F.png 114KB Sep 13 2013 07:32:48 AMScreenshot_9_13_13_7_30_AM_17E3598F.png
Screenshot_9_13_13_7_56_AM_17E35F4D.pngScreenshot_9_13_13_7_56_AM_17E35F4D.png 13KB Sep 13 2013 07:57:19 AMScreenshot_9_13_13_7_56_AM_17E35F4D.png
Screenshot_9_13_13_8_12_AM_17E36314.pngScreenshot_9_13_13_8_12_AM_17E36314.png 98KB Sep 13 2013 08:13:28 AMScreenshot_9_13_13_8_12_AM_17E36314.png
Screenshot_9_13_13_8_58_AM_17E36E27.pngScreenshot_9_13_13_8_58_AM_17E36E27.png 60KB Sep 13 2013 09:00:42 AMScreenshot_9_13_13_8_58_AM_17E36E27.png
Screenshot_9_13_13_9_08_AM_17E36FED.pngScreenshot_9_13_13_9_08_AM_17E36FED.png 44KB Sep 13 2013 09:08:15 AMScreenshot_9_13_13_9_08_AM_17E36FED.png
Screenshot_9_13_13_9_39_AM_17E3772C.pngScreenshot_9_13_13_9_39_AM_17E3772C.png 114KB Sep 13 2013 09:39:09 AMScreenshot_9_13_13_9_39_AM_17E3772C.png
Screenshot_9_13_13_9_40_AM_17E37780.pngScreenshot_9_13_13_9_40_AM_17E37780.png 50KB Sep 13 2013 09:40:33 AMScreenshot_9_13_13_9_40_AM_17E37780.png
Screenshot_9_13_13_9_43_AM_17E3786E.pngScreenshot_9_13_13_9_43_AM_17E3786E.png 93KB Sep 13 2013 09:44:31 AMScreenshot_9_13_13_9_43_AM_17E3786E.png
Screenshot_9_15_16__11_10_AM_1D8B1BA5.pngScreenshot_9_15_16__11_10_AM_1D8B1BA5.png 365KB Sep 15 2016 11:10:49 AMScreenshot_9_15_16__11_10_AM_1D8B1BA5.png
Screenshot_9_18_13_7_45_AM_17E9F41C.pngScreenshot_9_18_13_7_45_AM_17E9F41C.png 302KB Sep 18 2013 07:45:49 AMScreenshot_9_18_13_7_45_AM_17E9F41C.png
Screenshot_9_25_14_9_00_AM_19D473AA.pngScreenshot_9_25_14_9_00_AM_19D473AA.png 56KB Sep 25 2014 09:00:43 AMScreenshot_9_25_14_9_00_AM_19D473AA.png
Screenshot_9_25_14_9_52_AM_19D47FF5.pngScreenshot_9_25_14_9_52_AM_19D47FF5.png 177KB Sep 25 2014 09:53:10 AMScreenshot_9_25_14_9_52_AM_19D47FF5.png
Screenshot_9_25_14_9_56_AM_19D48238.pngScreenshot_9_25_14_9_56_AM_19D48238.png 42KB Sep 25 2014 10:02:49 AMScreenshot_9_25_14_9_56_AM_19D48238.png
Screenshot_9_28_15__9_31_AM_1BB9A34E.pngScreenshot_9_28_15__9_31_AM_1BB9A34E.png 78KB Sep 28 2015 09:33:20 AMScreenshot_9_28_15__9_31_AM_1BB9A34E.png
Screenshot_9_28_15__9_58_AM_1BB9A957.pngScreenshot_9_28_15__9_58_AM_1BB9A957.png 21KB Sep 28 2015 09:59:04 AMScreenshot_9_28_15__9_58_AM_1BB9A957.png
Screenshot_9_30_16__10_54_AM_1D9EDE68.pngScreenshot_9_30_16__10_54_AM_1D9EDE68.png 132KB Sep 30 2016 10:54:49 AMScreenshot_9_30_16__10_54_AM_1D9EDE68.png
Screenshot_9_30_16__11_03_AM_1D9EE072.pngScreenshot_9_30_16__11_03_AM_1D9EE072.png 49KB Sep 30 2016 11:03:31 AMScreenshot_9_30_16__11_03_AM_1D9EE072.png
Screenshot_9_30_16__11_23_AM_1D9EE516.pngScreenshot_9_30_16__11_23_AM_1D9EE516.png 48KB Sep 30 2016 11:23:20 AMScreenshot_9_30_16__11_23_AM_1D9EE516.png
Screenshot_10_3_16__7_52_AM_1DA2A855.pngScreenshot_10_3_16__7_52_AM_1DA2A855.png 917KB Oct 03 2016 07:53:12 AMScreenshot_10_3_16__7_52_AM_1DA2A855.png
Screenshot_10_3_16__7_52_AM_1DA2A912.pngScreenshot_10_3_16__7_52_AM_1DA2A912.png 930KB Oct 03 2016 07:56:19 AMScreenshot_10_3_16__7_52_AM_1DA2A912.png
Screenshot_10_10_13_12_12_PM_180733A0.pngScreenshot_10_10_13_12_12_PM_180733A0.png 216KB Oct 10 2013 12:12:33 PMScreenshot_10_10_13_12_12_PM_180733A0.png
Screenshot_10_10_13_12_12_PM_180733B7.pngScreenshot_10_10_13_12_12_PM_180733B7.png 216KB Oct 10 2013 12:12:56 PMScreenshot_10_10_13_12_12_PM_180733B7.png
Screenshot_10_24_13_1_28_PM_1819BAC5.pngScreenshot_10_24_13_1_28_PM_1819BAC5.png 126KB Oct 24 2013 01:30:01 PMScreenshot_10_24_13_1_28_PM_1819BAC5.png
Screenshot_10_24_16__8_10_AM_1DBE5C07.pngScreenshot_10_24_16__8_10_AM_1DBE5C07.png 112KB Oct 24 2016 08:11:05 AMScreenshot_10_24_16__8_10_AM_1DBE5C07.png
Screenshot_10_24_16__8_12_AM_1DBE5C48.pngScreenshot_10_24_16__8_12_AM_1DBE5C48.png 51KB Oct 24 2016 08:12:09 AMScreenshot_10_24_16__8_12_AM_1DBE5C48.png
Screenshot_10_24_16__8_19_AM_1DBE5DFC.pngScreenshot_10_24_16__8_19_AM_1DBE5DFC.png 111KB Oct 24 2016 08:19:27 AMScreenshot_10_24_16__8_19_AM_1DBE5DFC.png
Screenshot_11_14_16__8_24_AM_1DDA1CA8.pngScreenshot_11_14_16__8_24_AM_1DDA1CA8.png 42KB Nov 14 2016 08:24:11 AMScreenshot_11_14_16__8_24_AM_1DDA1CA8.png
Screenshot_12_6_13_7_14_AM_18522151.pngScreenshot_12_6_13_7_14_AM_18522151.png 135KB Dec 06 2013 07:14:26 AMScreenshot_12_6_13_7_14_AM_18522151.png
Screenshot_12_6_13_7_18_AM_18522243.pngScreenshot_12_6_13_7_18_AM_18522243.png 137KB Dec 06 2013 07:18:29 AMScreenshot_12_6_13_7_18_AM_18522243.png
Screenshot_12_6_13_7_19_AM_185222A2.pngScreenshot_12_6_13_7_19_AM_185222A2.png 109KB Dec 06 2013 07:20:04 AMScreenshot_12_6_13_7_19_AM_185222A2.png
Screenshot_12_6_13_7_21_AM_18522312.pngScreenshot_12_6_13_7_21_AM_18522312.png 149KB Dec 06 2013 07:21:56 AMScreenshot_12_6_13_7_21_AM_18522312.png
Screen_Capture_on_2017-02-15_at_06-49-26_gif_•_Droplr_1E54A7FD.pngScreen_Capture_on_2017-02-15_at_06-49-26... 480KB Feb 15 2017 07:15:10 AMScreen_Capture_on_2017-02-15_at_06-49-26_gif_•_Droplr_1E54A7FD.png
Screen_Shot_2016-01-29_at_12_01_46_PM_png_1C5C0012.pngScreen_Shot_2016-01-29_at_12_01_46_PM_pn... 174KB Jan 29 2016 12:16:21 PMScreen_Shot_2016-01-29_at_12_01_46_PM_png_1C5C0012.png
Screen_Shot_2016-02-09_at_11_30_23_AM_png_1C6A8C48.pngScreen_Shot_2016-02-09_at_11_30_23_AM_pn... 115KB Feb 09 2016 01:06:18 PMScreen_Shot_2016-02-09_at_11_30_23_AM_png_1C6A8C48.png
Screen_Shot_2016-02-09_at_11_40_09_AM_png_1C6A8BB6.pngScreen_Shot_2016-02-09_at_11_40_09_AM_pn... 179KB Feb 09 2016 01:03:54 PMScreen_Shot_2016-02-09_at_11_40_09_AM_png_1C6A8BB6.png
Sea_lamprey_panic_response_-_YouTube_19F17EF1.pngSea_lamprey_panic_response_-_YouTube_19F... 141KB Oct 17 2014 09:44:34 AMSea_lamprey_panic_response_-_YouTube_19F17EF1.png
Session__New_Session_18A6B255.pngSession__New_Session_18A6B255.png 102KB Feb 08 2014 10:45:51 AMSession__New_Session_18A6B255.png
Set_Up_Experiment_and_CLC_Genomics_Workbench_4.0.3__Current_workspace__Default__18917CDB.pngSet_Up_Experiment_and_CLC_Genomics_Workb... 203KB Jan 23 2014 08:39:06 AMSet_Up_Experiment_and_CLC_Genomics_Workbench_4.0.3__Current_workspace__Default__18917CDB.png
Shellfish_RNA_Boxes_-_Google_Sheets_1B151E2F.pngShellfish_RNA_Boxes_-_Google_Sheets_1B15... 326KB May 26 2015 02:33:36 PMShellfish_RNA_Boxes_-_Google_Sheets_1B151E2F.png
Shell_Reference_1A57585B.pngShell_Reference_1A57585B.png 9KB Jan 02 2015 02:51:07 PMShell_Reference_1A57585B.png
shibsp__ListenerException_and_data-genomic_1AA514F4.pngshibsp__ListenerException_and_data-genom... 44KB Mar 02 2015 02:00:20 PMshibsp__ListenerException_and_data-genomic_1AA514F4.png
Shrimp_-_Wikipedia__the_free_encyclopedia_1B0222FA.pngShrimp_-_Wikipedia__the_free_encyclopedi... 137KB May 12 2015 05:01:00 AMShrimp_-_Wikipedia__the_free_encyclopedia_1B0222FA.png
sh_1AA50F63.pngsh_1AA50F63.png 213KB Mar 02 2015 01:36:35 PMsh_1AA50F63.png
SIGNAL_TRANSDUCTION_-_YouTube_19D9A928.pngSIGNAL_TRANSDUCTION_-_YouTube_19D9A928.png 104KB Sep 29 2014 07:50:18 AMSIGNAL_TRANSDUCTION_-_YouTube_19D9A928.png
SimpleMind_Free_17A0A687.pngSimpleMind_Free_17A0A687.png 87KB Jul 24 2013 05:25:37 PMSimpleMind_Free_17A0A687.png
size_report_docx__page_1_of_2__1CC811CB.pngsize_report_docx__page_1_of_2__1CC811CB.png 88KB Apr 20 2016 12:36:45 PMsize_report_docx__page_1_of_2__1CC811CB.png
Space_Gremlin_1D789EFE.pngSpace_Gremlin_1D789EFE.png 212KB Sep 01 2016 10:38:09 AMSpace_Gremlin_1D789EFE.png
SpBase_19D1DAFD.pngSpBase_19D1DAFD.png 156KB Sep 23 2014 09:44:46 AMSpBase_19D1DAFD.png
splicing_diff_1AD2DFE8.pngsplicing_diff_1AD2DFE8.png 473KB Apr 06 2015 08:38:16 AMsplicing_diff_1AD2DFE8.png
splicing_diff_and_IGV_and_Fibrocystin-L_-_Google_Search_and_splicing_diff_1AD2E02E.pngsplicing_diff_and_IGV_and_Fibrocystin-L_... 120KB Apr 06 2015 08:39:26 AMsplicing_diff_and_IGV_and_Fibrocystin-L_-_Google_Search_and_splicing_diff_1AD2E02E.png
splicing_diff_and_IGV_and_Fibrocystin-L_-_Google_Search_and_splicing_diff_1AD2E085.pngsplicing_diff_and_IGV_and_Fibrocystin-L_... 120KB Apr 06 2015 08:40:53 AMsplicing_diff_and_IGV_and_Fibrocystin-L_-_Google_Search_and_splicing_diff_1AD2E085.png
SQLShare_-_View_Query_1A9FD73E.pngSQLShare_-_View_Query_1A9FD73E.png 230KB Feb 26 2015 02:35:42 PMSQLShare_-_View_Query_1A9FD73E.png
SQLShare_-_View_Query_1A61D549.pngSQLShare_-_View_Query_1A61D549.png 163KB Jan 10 2015 01:46:50 PMSQLShare_-_View_Query_1A61D549.png
SQLShare_-_View_Query_1B0104C8.pngSQLShare_-_View_Query_1B0104C8.png 161KB May 11 2015 08:39:52 AMSQLShare_-_View_Query_1B0104C8.png
SQLShare_-_View_Query_1BDA57BA.pngSQLShare_-_View_Query_1BDA57BA.png 90KB Oct 23 2015 04:55:41 AMSQLShare_-_View_Query_1BDA57BA.png
SQLShare_-_View_Query_1BDA559D.pngSQLShare_-_View_Query_1BDA559D.png 71KB Oct 23 2015 04:46:41 AMSQLShare_-_View_Query_1BDA559D.png
SQLShare_-_View_Query_1BDA676C.pngSQLShare_-_View_Query_1BDA676C.png 109KB Oct 23 2015 06:02:41 AMSQLShare_-_View_Query_1BDA676C.png
SQLShare_-_View_Query_1BDA5072.pngSQLShare_-_View_Query_1BDA5072.png 204KB Oct 23 2015 04:24:38 AMSQLShare_-_View_Query_1BDA5072.png
SQLShare_-_View_Query_1BDA6465.pngSQLShare_-_View_Query_1BDA6465.png 102KB Oct 23 2015 05:49:45 AMSQLShare_-_View_Query_1BDA6465.png
SQLShare_-_View_Query_1BF25BF8.pngSQLShare_-_View_Query_1BF25BF8.png 160KB Nov 10 2015 09:08:10 AMSQLShare_-_View_Query_1BF25BF8.png
SQLShare_-_View_Query_1BF25CC5.pngSQLShare_-_View_Query_1BF25CC5.png 60KB Nov 10 2015 09:11:33 AMSQLShare_-_View_Query_1BF25CC5.png
SQLShare_-_View_Query_1C2049C2.pngSQLShare_-_View_Query_1C2049C2.png 40KB Dec 15 2015 05:14:49 AMSQLShare_-_View_Query_1C2049C2.png
SQLShare_-_View_Query_1D959F1E.pngSQLShare_-_View_Query_1D959F1E.png 189KB Sep 23 2016 10:34:25 AMSQLShare_-_View_Query_1D959F1E.png
SQLShare_-_View_Query_1D958940.pngSQLShare_-_View_Query_1D958940.png 124KB Sep 23 2016 09:01:09 AMSQLShare_-_View_Query_1D958940.png
SQLShare_-_View_Query_1DC0E217.pngSQLShare_-_View_Query_1DC0E217.png 133KB Oct 26 2016 06:07:37 AMSQLShare_-_View_Query_1DC0E217.png
SQLShare_-_View_Query_1DC23EA1.pngSQLShare_-_View_Query_1DC23EA1.png 174KB Oct 27 2016 06:54:42 AMSQLShare_-_View_Query_1DC23EA1.png
SQLShare_-_View_Query_1DC23ED5.pngSQLShare_-_View_Query_1DC23ED5.png 126KB Oct 27 2016 06:55:33 AMSQLShare_-_View_Query_1DC23ED5.png
SQLShare_-_View_Query_17A40B5F.pngSQLShare_-_View_Query_17A40B5F.png 19KB Jul 27 2013 07:12:43 AMSQLShare_-_View_Query_17A40B5F.png
SQLShare_-_View_Query_17A40B53.pngSQLShare_-_View_Query_17A40B53.png 19KB Jul 27 2013 07:12:30 AMSQLShare_-_View_Query_17A40B53.png
SQLShare_-_View_Query_17A40CA5.pngSQLShare_-_View_Query_17A40CA5.png 23KB Jul 27 2013 07:18:09 AMSQLShare_-_View_Query_17A40CA5.png
SQLShare_-_View_Query_17A40CDF.pngSQLShare_-_View_Query_17A40CDF.png 23KB Jul 27 2013 07:19:07 AMSQLShare_-_View_Query_17A40CDF.png
SQLShare_-_View_Query_17A40EA0.pngSQLShare_-_View_Query_17A40EA0.png 18KB Jul 27 2013 07:26:36 AMSQLShare_-_View_Query_17A40EA0.png
SQLShare_-_View_Query_17A408ED.pngSQLShare_-_View_Query_17A408ED.png 11KB Jul 27 2013 07:02:25 AMSQLShare_-_View_Query_17A408ED.png
SQLShare_-_View_Query_17A4091E.pngSQLShare_-_View_Query_17A4091E.png 42KB Jul 27 2013 07:03:06 AMSQLShare_-_View_Query_17A4091E.png
SQLShare_-_View_Query_17B02CD9.pngSQLShare_-_View_Query_17B02CD9.png 71KB Aug 05 2013 12:03:16 PMSQLShare_-_View_Query_17B02CD9.png
SQLShare_-_View_Query_17BFC14D.pngSQLShare_-_View_Query_17BFC14D.png 114KB Aug 17 2013 07:41:15 AMSQLShare_-_View_Query_17BFC14D.png
SQLShare_-_View_Query_17BFCD69.pngSQLShare_-_View_Query_17BFCD69.png 103KB Aug 17 2013 08:32:55 AMSQLShare_-_View_Query_17BFCD69.png
SQLShare_-_View_Query_17CE9DE9.pngSQLShare_-_View_Query_17CE9DE9.png 87KB Aug 28 2013 02:14:55 PMSQLShare_-_View_Query_17CE9DE9.png
SQLShare_-_View_Query_17E351B7.pngSQLShare_-_View_Query_17E351B7.png 65KB Sep 13 2013 06:59:22 AMSQLShare_-_View_Query_17E351B7.png
SQLShare_-_View_Query_18B006DC.pngSQLShare_-_View_Query_18B006DC.png 37KB Feb 15 2014 12:34:39 PMSQLShare_-_View_Query_18B006DC.png
SQLShare_-_View_Query_18EEEE73.pngSQLShare_-_View_Query_18EEEE73.png 80KB Apr 04 2014 06:43:17 AMSQLShare_-_View_Query_18EEEE73.png
SQLShare_-_View_Query_18F591B3.pngSQLShare_-_View_Query_18F591B3.png 93KB Apr 09 2014 07:33:24 AMSQLShare_-_View_Query_18F591B3.png
SQLShare_-_View_Query_18F5948F.pngSQLShare_-_View_Query_18F5948F.png 115KB Apr 09 2014 07:45:36 AMSQLShare_-_View_Query_18F5948F.png
SQLShare_-_View_Query_18F5959E.pngSQLShare_-_View_Query_18F5959E.png 83KB Apr 09 2014 07:50:07 AMSQLShare_-_View_Query_18F5959E.png
SQLShare_-_View_Query_18F5994E.pngSQLShare_-_View_Query_18F5994E.png 126KB Apr 09 2014 08:05:51 AMSQLShare_-_View_Query_18F5994E.png
SQLShare_-_View_Query_18F5996D.pngSQLShare_-_View_Query_18F5996D.png 151KB Apr 09 2014 08:06:22 AMSQLShare_-_View_Query_18F5996D.png
SQLShare_-_View_Query_19D46DB1.pngSQLShare_-_View_Query_19D46DB1.png 84KB Sep 25 2014 08:35:15 AMSQLShare_-_View_Query_19D46DB1.png
SQLShare_-_View_Query_182D1DA4.pngSQLShare_-_View_Query_182D1DA4.png 55KB Nov 08 2013 05:24:56 AMSQLShare_-_View_Query_182D1DA4.png
SQLShare_-_View_Query_187B13C2.pngSQLShare_-_View_Query_187B13C2.png 133KB Jan 06 2014 08:39:31 AMSQLShare_-_View_Query_187B13C2.png
SQLShare_-_View_Query_187B18DE.pngSQLShare_-_View_Query_187B18DE.png 92KB Jan 06 2014 09:01:18 AMSQLShare_-_View_Query_187B18DE.png
SQLShare_-_View_Query_187B26E4.pngSQLShare_-_View_Query_187B26E4.png 86KB Jan 06 2014 10:01:09 AMSQLShare_-_View_Query_187B26E4.png
SQLShare_-_View_Query_187B135C.pngSQLShare_-_View_Query_187B135C.png 133KB Jan 06 2014 08:37:50 AMSQLShare_-_View_Query_187B135C.png
SQLShare_-_View_Query_187B2554.pngSQLShare_-_View_Query_187B2554.png 111KB Jan 06 2014 09:54:29 AMSQLShare_-_View_Query_187B2554.png
SQLShare_-_View_Query_187B2638.pngSQLShare_-_View_Query_187B2638.png 59KB Jan 06 2014 09:58:17 AMSQLShare_-_View_Query_187B2638.png
SQLShare_-_View_Query_189AB723.pngSQLShare_-_View_Query_189AB723.png 77KB Jan 30 2014 08:38:32 AMSQLShare_-_View_Query_189AB723.png
SQLShare_-_View_Query_1805A472.pngSQLShare_-_View_Query_1805A472.png 20KB Oct 09 2013 07:49:23 AMSQLShare_-_View_Query_1805A472.png
SQLShare_-_View_Query_1805EADF.pngSQLShare_-_View_Query_1805EADF.png 18KB Oct 09 2013 12:49:52 PMSQLShare_-_View_Query_1805EADF.png
SQLShare_-_View_Query_1805EB60.pngSQLShare_-_View_Query_1805EB60.png 19KB Oct 09 2013 12:52:02 PMSQLShare_-_View_Query_1805EB60.png
SQLShare_-_View_Query_1875ED4C.pngSQLShare_-_View_Query_1875ED4C.png 77KB Jan 02 2014 10:54:05 AMSQLShare_-_View_Query_1875ED4C.png
SQLShare_-_View_Query_1875F0AE.pngSQLShare_-_View_Query_1875F0AE.png 87KB Jan 02 2014 11:08:31 AMSQLShare_-_View_Query_1875F0AE.png
SQLShare_-_View_Query_1875F023.pngSQLShare_-_View_Query_1875F023.png 42KB Jan 02 2014 11:06:12 AMSQLShare_-_View_Query_1875F023.png
SQLShare_-_View_Query_1875F4FE.pngSQLShare_-_View_Query_1875F4FE.png 92KB Jan 02 2014 11:26:55 AMSQLShare_-_View_Query_1875F4FE.png
SQLShare_-_View_Query_1875F5A6.pngSQLShare_-_View_Query_1875F5A6.png 87KB Jan 02 2014 11:29:43 AMSQLShare_-_View_Query_1875F5A6.png
SQLShare_-_View_Query_1875F135.pngSQLShare_-_View_Query_1875F135.png 107KB Jan 02 2014 11:10:46 AMSQLShare_-_View_Query_1875F135.png
SQLShare_-_View_Query_1949FA43.pngSQLShare_-_View_Query_1949FA43.png 57KB Jun 12 2014 08:09:57 AMSQLShare_-_View_Query_1949FA43.png
SQLShare_-_View_Query_18760C01.pngSQLShare_-_View_Query_18760C01.png 84KB Jan 02 2014 01:05:07 PMSQLShare_-_View_Query_18760C01.png
SQLShare_-_View_Query_180723F6.pngSQLShare_-_View_Query_180723F6.png 21KB Oct 10 2013 11:05:43 AMSQLShare_-_View_Query_180723F6.png
SQLShare_-_View_Query_187605FC.pngSQLShare_-_View_Query_187605FC.png 75KB Jan 02 2014 12:39:25 PMSQLShare_-_View_Query_187605FC.png
SQLShare_-_View_Query_187606B9.pngSQLShare_-_View_Query_187606B9.png 75KB Jan 02 2014 12:42:34 PMSQLShare_-_View_Query_187606B9.png
SQLShare_-_View_Query_187606F3.pngSQLShare_-_View_Query_187606F3.png 77KB Jan 02 2014 12:43:32 PMSQLShare_-_View_Query_187606F3.png
SQLShare_-_View_Query_187607A3.pngSQLShare_-_View_Query_187607A3.png 75KB Jan 02 2014 12:46:28 PMSQLShare_-_View_Query_187607A3.png
SQLShare_-_View_Query_189203ED.pngSQLShare_-_View_Query_189203ED.png 89KB Jan 23 2014 06:15:26 PMSQLShare_-_View_Query_189203ED.png
SQLShare_-_View_Query_1819790D.pngSQLShare_-_View_Query_1819790D.png 55KB Oct 24 2013 08:49:43 AMSQLShare_-_View_Query_1819790D.png
SQLShare_-_View_Query_1876086C.pngSQLShare_-_View_Query_1876086C.png 130KB Jan 02 2014 12:49:49 PMSQLShare_-_View_Query_1876086C.png
SQLShare_-_View_Query_18072423.pngSQLShare_-_View_Query_18072423.png 20KB Oct 10 2013 11:06:29 AMSQLShare_-_View_Query_18072423.png
SQLShare_-_View_Query_18760674.pngSQLShare_-_View_Query_18760674.png 72KB Jan 02 2014 12:41:25 PMSQLShare_-_View_Query_18760674.png
SQLShare_-_View_Query_18760809.pngSQLShare_-_View_Query_18760809.png 107KB Jan 02 2014 12:48:09 PMSQLShare_-_View_Query_18760809.png
SQLShare_-_View_Query_and_01-Ostrea-blast_1DBCFA32.pngSQLShare_-_View_Query_and_01-Ostrea-blas... 230KB Oct 23 2016 07:01:26 AMSQLShare_-_View_Query_and_01-Ostrea-blast_1DBCFA32.png
SQLShare_-_View_Query_and_SQLShare_187B14E1.pngSQLShare_-_View_Query_and_SQLShare_187B1... 230KB Jan 06 2014 08:44:18 AMSQLShare_-_View_Query_and_SQLShare_187B14E1.png
SQLShare_-_View_Query_and_SQLShare_187B1477.pngSQLShare_-_View_Query_and_SQLShare_187B1... 240KB Jan 06 2014 08:42:33 AMSQLShare_-_View_Query_and_SQLShare_187B1477.png
SQLShare_1DC23CC6.pngSQLShare_1DC23CC6.png 193KB Oct 27 2016 06:46:47 AMSQLShare_1DC23CC6.png
SQLShare_187B106E.pngSQLShare_187B106E.png 195KB Jan 06 2014 08:25:18 AMSQLShare_187B106E.png
SQLShare_187B1067.pngSQLShare_187B1067.png 195KB Jan 06 2014 08:25:13 AMSQLShare_187B1067.png
SQLShare_1991CE47.pngSQLShare_1991CE47.png 54KB Aug 05 2014 07:45:29 PMSQLShare_1991CE47.png
SQLShare_and_README.md_and_SQLShare_187B110A.pngSQLShare_and_README.md_and_SQLShare_187B... 150KB Jan 06 2014 08:27:56 AMSQLShare_and_README.md_and_SQLShare_187B110A.png
Sqlshare_Graphs_181B07AF.pngSqlshare_Graphs_181B07AF.png 150KB Oct 25 2013 01:10:25 PMSqlshare_Graphs_181B07AF.png
Sqlshare_Graphs_181B07B6.pngSqlshare_Graphs_181B07B6.png 150KB Oct 25 2013 01:10:34 PMSqlshare_Graphs_181B07B6.png
SQLShare_workflow_for_proteomics_analysis_1BBEF64E.pngSQLShare_workflow_for_proteomics_analysi... 307KB Oct 02 2015 10:28:46 AMSQLShare_workflow_for_proteomics_analysis_1BBEF64E.png
sr320_austral_1A726CBB.pngsr320_austral_1A726CBB.png 97KB Jan 23 2015 03:49:19 AMsr320_austral_1A726CBB.png
sr320_eimd-sswd_1BBEF81A.pngsr320_eimd-sswd_1BBEF81A.png 228KB Oct 02 2015 10:36:26 AMsr320_eimd-sswd_1BBEF81A.png
sr320_eimd-sswd_1DBE62BE.pngsr320_eimd-sswd_1DBE62BE.png 262KB Oct 24 2016 08:39:48 AMsr320_eimd-sswd_1DBE62BE.png
sr320_fish546_18BD03A5.pngsr320_fish546_18BD03A5.png 83KB Feb 25 2014 09:00:21 AMsr320_fish546_18BD03A5.png
sr320_github_io_Fidalgo-Siblings-BS-genefish-10k_ipynb_at_master_·_sr320_sr320_github_io_1DDA4CB0.pngsr320_github_io_Fidalgo-Siblings-BS-gene... 164KB Nov 14 2016 11:49:07 AMsr320_github_io_Fidalgo-Siblings-BS-genefish-10k_ipynb_at_master_·_sr320_sr320_github_io_1DDA4CB0.png
sr320_paper-Oyster-EE2_1BC01BD3.pngsr320_paper-Oyster-EE2_1BC01BD3.png 118KB Oct 03 2015 07:21:09 AMsr320_paper-Oyster-EE2_1BC01BD3.png
sr320_paper-Oyster-EE2_1BC01C04.pngsr320_paper-Oyster-EE2_1BC01C04.png 146KB Oct 03 2015 07:21:57 AMsr320_paper-Oyster-EE2_1BC01C04.png
sr320_tumblr_com_1A018930.pngsr320_tumblr_com_1A018930.png 89KB Oct 29 2014 01:44:33 PMsr320_tumblr_com_1A018930.png
sr320__Steven_Roberts__19E81944.pngsr320__Steven_Roberts__19E81944.png 70KB Oct 10 2014 06:40:22 AMsr320__Steven_Roberts__19E81944.png
sr320’s_iMac_1B3AFBCC.pngsr320’s_iMac_1B3AFBCC.png 85KB Jun 24 2015 07:53:02 AMsr320’s_iMac_1B3AFBCC.png
sr320’s_iMac_1B3AFCCC.pngsr320’s_iMac_1B3AFCCC.png 83KB Jun 24 2015 07:57:17 AMsr320’s_iMac_1B3AFCCC.png
sr320’s_iMac_1C0748FB.pngsr320’s_iMac_1C0748FB.png 130KB Nov 26 2015 06:04:40 AMsr320’s_iMac_1C0748FB.png
sr320’s_iMac_1C5A4CD0.pngsr320’s_iMac_1C5A4CD0.png 34KB Jan 28 2016 05:19:14 AMsr320’s_iMac_1C5A4CD0.png
sr320’s_iMac_1CEE2AFA.pngsr320’s_iMac_1CEE2AFA.png 54KB May 19 2016 10:10:23 AMsr320’s_iMac_1CEE2AFA.png
sr320’s_iMac_1DBAB75A.pngsr320’s_iMac_1DBAB75A.png 48KB Oct 21 2016 01:51:44 PMsr320’s_iMac_1DBAB75A.png
sr320’s_iMac_1DD7B6AC.pngsr320’s_iMac_1DD7B6AC.png 790KB Nov 12 2016 12:44:34 PMsr320’s_iMac_1DD7B6AC.png
sr320’s_iMac_1DD68F33.pngsr320’s_iMac_1DD68F33.png 227KB Nov 11 2016 03:43:49 PMsr320’s_iMac_1DD68F33.png
sr320’s_iMac_1E19F59A.pngsr320’s_iMac_1E19F59A.png 80KB Jan 01 2017 06:42:38 PMsr320’s_iMac_1E19F59A.png
sr320’s_iMac_1E493C15.pngsr320’s_iMac_1E493C15.png 187KB Feb 06 2017 03:19:54 PMsr320’s_iMac_1E493C15.png
sr320’s_iMac_1E493C96.pngsr320’s_iMac_1E493C96.png 108KB Feb 06 2017 03:22:01 PMsr320’s_iMac_1E493C96.png
sr320’s_iMac_1E493DD8.pngsr320’s_iMac_1E493DD8.png 90KB Feb 06 2017 03:27:21 PMsr320’s_iMac_1E493DD8.png
SRP032997_-_SRA_-_NCBI_1A8BC90A.pngSRP032997_-_SRA_-_NCBI_1A8BC90A.png 44KB Feb 11 2015 09:29:47 AMSRP032997_-_SRA_-_NCBI_1A8BC90A.png
Strongylocentrotus_purpuratus_-_Ensembl_Genomes_19D1DC61.pngStrongylocentrotus_purpuratus_-_Ensembl_... 243KB Sep 23 2014 09:50:44 AMStrongylocentrotus_purpuratus_-_Ensembl_Genomes_19D1DC61.png
student-fish546-2016_05-Getting-IGV-ready_ipynb_at_master_·_sr320_student-fish546-2016_1DC3C40C.pngstudent-fish546-2016_05-Getting-IGV-read... 105KB Oct 28 2016 10:36:14 AMstudent-fish546-2016_05-Getting-IGV-ready_ipynb_at_master_·_sr320_student-fish546-2016_1DC3C40C.png
student-fish546-2016_1DA1944F.pngstudent-fish546-2016_1DA1944F.png 21KB Oct 02 2016 12:15:28 PMstudent-fish546-2016_1DA1944F.png
student-fish546-2016_1DB6987A.pngstudent-fish546-2016_1DB6987A.png 153KB Oct 18 2016 10:50:54 AMstudent-fish546-2016_1DB6987A.png
Submissions___BioSample___Submission_Portal_1A3B43AC.pngSubmissions___BioSample___Submission_Por... 22KB Dec 12 2014 07:39:25 AMSubmissions___BioSample___Submission_Portal_1A3B43AC.png
Submissions___BioSample___Submission_Portal_1A3B4709.pngSubmissions___BioSample___Submission_Por... 27KB Dec 12 2014 07:53:46 AMSubmissions___BioSample___Submission_Portal_1A3B4709.png
Submission___Submit___Sequence_Read_Archive___NCBI_NLM_NIH_v_0_7_2_1A3B4F67.pngSubmission___Submit___Sequence_Read_Arch... 39KB Dec 12 2014 08:29:27 AMSubmission___Submit___Sequence_Read_Archive___NCBI_NLM_NIH_v_0_7_2_1A3B4F67.png
Submission___Submit___Sequence_Read_Archive___NCBI_NLM_NIH_v_0_7_2_1A3B4FA5.pngSubmission___Submit___Sequence_Read_Arch... 80KB Dec 12 2014 08:30:30 AMSubmission___Submit___Sequence_Read_Archive___NCBI_NLM_NIH_v_0_7_2_1A3B4FA5.png
Submission___Submit___Sequence_Read_Archive___NCBI_NLM_NIH_v_0_7_2_1A3B5924.pngSubmission___Submit___Sequence_Read_Arch... 123KB Dec 12 2014 09:11:02 AMSubmission___Submit___Sequence_Read_Archive___NCBI_NLM_NIH_v_0_7_2_1A3B5924.png
suppression_by_virus_of_host_MAVS_activity_-_BioSystems_-_NCBI_199D82DB.pngsuppression_by_virus_of_host_MAVS_activi... 60KB Aug 14 2014 04:50:53 PMsuppression_by_virus_of_host_MAVS_activity_-_BioSystems_-_NCBI_199D82DB.png
Supp_Data_protein_annotations.xlsx_179F07CB.pngSupp_Data_protein_annotations.xlsx_179F0... 65KB Jul 23 2013 11:55:57 AMSupp_Data_protein_annotations.xlsx_179F07CB.png
Supp_Data_protein_annotations.xlsx_179F08A3.pngSupp_Data_protein_annotations.xlsx_179F0... 65KB Jul 23 2013 11:59:33 AMSupp_Data_protein_annotations.xlsx_179F08A3.png
Supp_Data_protein_annotations.xlsx_179F08E6.pngSupp_Data_protein_annotations.xlsx_179F0... 65KB Jul 23 2013 12:00:40 PMSupp_Data_protein_annotations.xlsx_179F08E6.png
System-diagram_1C712DA9.pngSystem-diagram_1C712DA9.png 63KB Feb 14 2016 01:48:29 PMSystem-diagram_1C712DA9.png
System-diagram_key_1C73F50E.pngSystem-diagram_key_1C73F50E.png 97KB Feb 16 2016 04:23:45 PMSystem-diagram_key_1C73F50E.png
System-diagram_key_1C73F707.pngSystem-diagram_key_1C73F707.png 66KB Feb 16 2016 04:32:10 PMSystem-diagram_key_1C73F707.png
System_Update_Required_1BB9A08A.pngSystem_Update_Required_1BB9A08A.png 22KB Sep 28 2015 09:21:30 AMSystem_Update_Required_1BB9A08A.png
Tab_to_Fasta_Sequence_Converter_1B013512.pngTab_to_Fasta_Sequence_Converter_1B013512... 78KB May 11 2015 12:05:55 PMTab_to_Fasta_Sequence_Converter_1B013512.png
talk-safs-2015_2015-SAFS-Roberts-SLIDES_pdf_at_master_·_sr320_talk-safs-2015_1AE05A70.pngtalk-safs-2015_2015-SAFS-Roberts-SLIDES_... 254KB Apr 16 2015 02:00:33 PMtalk-safs-2015_2015-SAFS-Roberts-SLIDES_pdf_at_master_·_sr320_talk-safs-2015_1AE05A70.png
talk-safs-2015_2015-SAFS-Roberts-SLIDES_pdf_at_master_·_sr320_talk-safs-2015_1AE05A73.pngtalk-safs-2015_2015-SAFS-Roberts-SLIDES_... 254KB Apr 16 2015 02:00:36 PMtalk-safs-2015_2015-SAFS-Roberts-SLIDES_pdf_at_master_·_sr320_talk-safs-2015_1AE05A73.png
Taxonomy_browser__Argopecten__19806C79.pngTaxonomy_browser__Argopecten__19806C79.png 128KB Jul 23 2014 03:19:38 PMTaxonomy_browser__Argopecten__19806C79.png
Taxonomy_browser__Veneroida__18CEAA35.pngTaxonomy_browser__Veneroida__18CEAA35.png 41KB Mar 10 2014 07:19:33 PMTaxonomy_browser__Veneroida__18CEAA35.png
Temperature_Data_–_Ocean_Acidification_1C87B035.pngTemperature_Data_–_Ocean_Acidification... 53KB Mar 02 2016 03:35:19 PMTemperature_Data_–_Ocean_Acidification_1C87B035.png
Temperature_influence_on_DNA_methylation_in_oysters___Authorea_1B3DB580.pngTemperature_influence_on_DNA_methylation... 64KB Jun 26 2015 09:29:52 AMTemperature_influence_on_DNA_methylation_in_oysters___Authorea_1B3DB580.png
tentacle_1BBC74BF.pngtentacle_1BBC74BF.png 117KB Sep 30 2015 12:51:29 PMtentacle_1BBC74BF.png
Terminal_1A093F1D.pngTerminal_1A093F1D.png 48KB Nov 04 2014 09:06:39 AMTerminal_1A093F1D.png
test_5_is_now_–_quarter-shell_–_Staging_for_my_Lab_Notebook_and_post_sh_1DBFD840.pngtest_5_is_now_–_quarter-shell_–_Stag... 41KB Oct 25 2016 11:13:28 AMtest_5_is_now_–_quarter-shell_–_Staging_for_my_Lab_Notebook_and_post_sh_1DBFD840.png
test_pdf__1_page__191D2160.pngtest_pdf__1_page__191D2160.png 110KB May 09 2014 07:44:48 AMtest_pdf__1_page__191D2160.png
the_eagle_17A0B185.pngthe_eagle_17A0B185.png 30KB Jul 24 2013 06:12:28 PMthe_eagle_17A0B185.png
The_Endocrine_System_-_YouTube_19E9841F.pngThe_Endocrine_System_-_YouTube_19E9841F.png 83KB Oct 11 2014 08:28:31 AMThe_Endocrine_System_-_YouTube_19E9841F.png
The_page_is_not_found_179EE1E2.pngThe_page_is_not_found_179EE1E2.png 36KB Jul 23 2013 09:14:12 AMThe_page_is_not_found_179EE1E2.png
Timmins-Schiffman-JPRv4-sr_docx_1E0D8B34.pngTimmins-Schiffman-JPRv4-sr_docx_1E0D8B34... 85KB Dec 23 2016 08:41:25 AMTimmins-Schiffman-JPRv4-sr_docx_1E0D8B34.png
Timmins-Schiffman-JPRv4-sr_docx_1E0D8BEB.pngTimmins-Schiffman-JPRv4-sr_docx_1E0D8BEB... 60KB Dec 23 2016 08:44:28 AMTimmins-Schiffman-JPRv4-sr_docx_1E0D8BEB.png
Timmins-Schiffman__E_et_al___2014___Shotgun_proteomics_reveals_physiological_response_to_ocean_acidification_in_Crassostrea_gigas_1BBEF6C2.pngTimmins-Schiffman__E_et_al___2014___Shot... 377KB Oct 02 2015 10:30:43 AMTimmins-Schiffman__E_et_al___2014___Shotgun_proteomics_reveals_physiological_response_to_ocean_acidification_in_Crassostrea_gigas_1BBEF6C2.png
tissue-layout_1B7AA56F.pngtissue-layout_1B7AA56F.png 650KB Aug 11 2015 02:49:34 PMtissue-layout_1B7AA56F.png
TJGR_Tandem_Repeats_and_TEs_1A38A6C3.pngTJGR_Tandem_Repeats_and_TEs_1A38A6C3.png 54KB Dec 10 2014 08:05:24 AMTJGR_Tandem_Repeats_and_TEs_1A38A6C3.png
TJGR_Tandem_Repeats_and_TEs_1A38A842.pngTJGR_Tandem_Repeats_and_TEs_1A38A842.png 100KB Dec 10 2014 08:11:47 AMTJGR_Tandem_Repeats_and_TEs_1A38A842.png
TopHat_1A438097.pngTopHat_1A438097.png 51KB Dec 18 2014 01:37:29 PMTopHat_1A438097.png
TopHat_1DBE5B6E.pngTopHat_1DBE5B6E.png 123KB Oct 24 2016 08:08:34 AMTopHat_1DBE5B6E.png
Top_Hat_18FECF96.pngTop_Hat_18FECF96.png 52KB Apr 16 2014 07:47:53 AMTop_Hat_18FECF96.png
transcription_and_translation_1B00E632.pngtranscription_and_translation_1B00E632.png 80KB May 11 2015 06:29:23 AMtranscription_and_translation_1B00E632.png
Transcriptome-Comparison_1B01067A.pngTranscriptome-Comparison_1B01067A.png 47KB May 11 2015 08:47:06 AMTranscriptome-Comparison_1B01067A.png
Transcriptome_assembly_methods_-_roberts_sbr_gmail_com_-_Gmail_1B3CA0E5.pngTranscriptome_assembly_methods_-_roberts... 182KB Jun 25 2015 01:49:41 PMTranscriptome_assembly_methods_-_roberts_sbr_gmail_com_-_Gmail_1B3CA0E5.png
Transcriptome_of_American_oysters__Crassostrea_virginica__in_response____-_SRA_-_NCBI_and_Aspera_Connect_Installer_1A8BCA2D.pngTranscriptome_of_American_oysters__Crass... 219KB Feb 11 2015 09:34:37 AMTranscriptome_of_American_oysters__Crassostrea_virginica__in_response____-_SRA_-_NCBI_and_Aspera_Connect_Installer_1A8BCA2D.png
Transcriptome_of_Crassostrea_virginica_-_SRA_-_NCBI_1A8BC994.pngTranscriptome_of_Crassostrea_virginica_-... 85KB Feb 11 2015 09:32:04 AMTranscriptome_of_Crassostrea_virginica_-_SRA_-_NCBI_1A8BC994.png
Transrate_-_transcriptome_assembly_quality_analysis_1DBE53AF.pngTransrate_-_transcriptome_assembly_quali... 119KB Oct 24 2016 07:35:34 AMTransrate_-_transcriptome_assembly_quality_analysis_1DBE53AF.png
tree_png_and_Printer-Friendly_Page_pdf__1_page__1E82C920.pngtree_png_and_Printer-Friendly_Page_pdf__... 34KB Mar 22 2017 08:00:50 AMtree_png_and_Printer-Friendly_Page_pdf__1_page__1E82C920.png
trilobite_180F5726.pngtrilobite_180F5726.png 60KB Oct 16 2013 04:22:16 PMtrilobite_180F5726.png
trilobite_and_BiGo_Larvae_and_Mackenzie_Gavery_1892E4D6.pngtrilobite_and_BiGo_Larvae_and_Mackenzie_... 339KB Jan 24 2014 10:15:05 AMtrilobite_and_BiGo_Larvae_and_Mackenzie_Gavery_1892E4D6.png
trinity_out_dir_1B54203C.pngtrinity_out_dir_1B54203C.png 337KB Jul 13 2015 09:34:54 AMtrinity_out_dir_1B54203C.png
Trinity_Transcript_Quantification_·_trinityrnaseq_trinityrnaseq_Wiki_1DBE5496.pngTrinity_Transcript_Quantification_·_tri... 40KB Oct 24 2016 07:39:20 AMTrinity_Transcript_Quantification_·_trinityrnaseq_trinityrnaseq_Wiki_1DBE5496.png
Trips___A114074___Steven_Roberts_1CD943C0.pngTrips___A114074___Steven_Roberts_1CD943C... 184KB May 03 2016 01:38:27 PMTrips___A114074___Steven_Roberts_1CD943C0.png
Tris_buffer_recipe_1C71167D.pngTris_buffer_recipe_1C71167D.png 78KB Feb 14 2016 12:09:36 PMTris_buffer_recipe_1C71167D.png
tube_17D0F8FE.pngtube_17D0F8FE.png 685KB Aug 30 2013 09:08:09 AMtube_17D0F8FE.png
txid6580_Organism_exp__-_Nucleotide_-_NCBI_18CEAB78.pngtxid6580_Organism_exp__-_Nucleotide_-_NC... 118KB Mar 10 2014 07:24:56 PMtxid6580_Organism_exp__-_Nucleotide_-_NCBI_18CEAB78.png
txid129788_Organism_noexp__washington_-_Nucleotide_-_NCBI_1BC3E51C.pngtxid129788_Organism_noexp__washington_-_... 134KB Oct 06 2015 04:16:46 AMtxid129788_Organism_noexp__washington_-_Nucleotide_-_NCBI_1BC3E51C.png
Underwater_video_of_low_dissolved_oxygen_event_in_Hood_Canal_-_YouTube_19E2E469.pngUnderwater_video_of_low_dissolved_oxygen... 280KB Oct 06 2014 07:53:32 AMUnderwater_video_of_low_dissolved_oxygen_event_in_Hood_Canal_-_YouTube_19E2E469.png
UniProt_1D8B1472.pngUniProt_1D8B1472.png 127KB Sep 15 2016 10:40:07 AMUniProt_1D8B1472.png
Untitled_-_Google_Chrome_1BB9ABCE.pngUntitled_-_Google_Chrome_1BB9ABCE.png 72KB Sep 28 2015 10:09:35 AMUntitled_-_Google_Chrome_1BB9ABCE.png
Untitled_-_Google_Chrome_1BB9ABEB.pngUntitled_-_Google_Chrome_1BB9ABEB.png 72KB Sep 28 2015 10:10:04 AMUntitled_-_Google_Chrome_1BB9ABEB.png
Untitled_1B4C7BBC.pngUntitled_1B4C7BBC.png 87KB Jul 07 2015 02:27:20 PMUntitled_1B4C7BBC.png
Untitled_1DAED861.pngUntitled_1DAED861.png 60KB Oct 12 2016 01:45:36 PMUntitled_1DAED861.png
Untitled_18E0D1A8.pngUntitled_18E0D1A8.png 111KB Mar 24 2014 01:48:42 PMUntitled_18E0D1A8.png
Untitled_180A143B.pngUntitled_180A143B.png 56KB Oct 12 2013 04:35:25 PMUntitled_180A143B.png
Untitled_182BC591.pngUntitled_182BC591.png 9KB Nov 07 2013 04:56:52 AMUntitled_182BC591.png
Untitled_and_17-06-19_and_17-06-19_and_17-06-19_—_bash_—_80×27_1EFAC537.pngUntitled_and_17-06-19_and_17-06-19_and_1... 113KB Jun 21 2017 08:16:09 AMUntitled_and_17-06-19_and_17-06-19_and_17-06-19_—_bash_—_80×27_1EFAC537.png
untitled_text_1DD61743.pnguntitled_text_1DD61743.png 146KB Nov 11 2016 07:12:05 AMuntitled_text_1DD61743.png
untitled_text_and_Abacus_parameters_txt_1E53BCE2.pnguntitled_text_and_Abacus_parameters_txt_... 506KB Feb 14 2017 02:32:33 PMuntitled_text_and_Abacus_parameters_txt_1E53BCE2.png
untitled__1_.csv_17E35B41.pnguntitled__1_.csv_17E35B41.png 193KB Sep 13 2013 07:40:02 AMuntitled__1_.csv_17E35B41.png
Update__reset_scss_·_sr320_sr320_github_io_a30b228_1D9DA9C6.pngUpdate__reset_scss_·_sr320_sr320_github... 78KB Sep 29 2016 12:58:00 PMUpdate__reset_scss_·_sr320_sr320_github_io_a30b228_1D9DA9C6.png
Upload_File_1A61D49E.pngUpload_File_1A61D49E.png 121KB Jan 10 2015 01:44:01 PMUpload_File_1A61D49E.png
Upload_File_1DC0E17A.pngUpload_File_1DC0E17A.png 71KB Oct 26 2016 06:05:01 AMUpload_File_1DC0E17A.png
Upload_File_187B115D.pngUpload_File_187B115D.png 152KB Jan 06 2014 08:29:18 AMUpload_File_187B115D.png
Upload_File_187B1184.pngUpload_File_187B1184.png 56KB Jan 06 2014 08:29:57 AMUpload_File_187B1184.png
Upload_File_1885F6E9.pngUpload_File_1885F6E9.png 65KB Jan 14 2014 02:52:11 PMUpload_File_1885F6E9.png
USDA-NSA-Workshop__1_page__1AA77142.pngUSDA-NSA-Workshop__1_page__1AA77142.png 529KB Mar 04 2015 08:58:43 AMUSDA-NSA-Workshop__1_page__1AA77142.png
usearch_1A0D1FC4.pngusearch_1A0D1FC4.png 155KB Nov 07 2014 07:41:58 AMusearch_1A0D1FC4.png
usearch_1A0D1FC8.pngusearch_1A0D1FC8.png 155KB Nov 07 2014 07:42:01 AMusearch_1A0D1FC8.png
util_1C12381C.pngutil_1C12381C.png 28KB Dec 04 2015 01:07:45 PMutil_1C12381C.png
util_1C123826.pngutil_1C123826.png 28KB Dec 04 2015 01:07:54 PMutil_1C123826.png
UW_4_0_Grade_Scale_1B1CF775.pngUW_4_0_Grade_Scale_1B1CF775.png 74KB Jun 01 2015 01:26:29 PMUW_4_0_Grade_Scale_1B1CF775.png
UW_4_0_Grade_Scale_1CC530FF.pngUW_4_0_Grade_Scale_1CC530FF.png 57KB Apr 18 2016 08:13:07 AMUW_4_0_Grade_Scale_1CC530FF.png
View_of_Nightingales_-_Google_Fusion_Tables_1A4246EE.pngView_of_Nightingales_-_Google_Fusion_Tab... 48KB Dec 17 2014 03:19:11 PMView_of_Nightingales_-_Google_Fusion_Tables_1A4246EE.png
vm64-127_1__sr320_-_VNC_Viewer_1A438287.pngvm64-127_1__sr320_-_VNC_Viewer_1A438287.png 208KB Dec 18 2014 01:45:45 PMvm64-127_1__sr320_-_VNC_Viewer_1A438287.png
vm64-127_1__sr320_-_VNC_Viewer_1A439789.pngvm64-127_1__sr320_-_VNC_Viewer_1A439789.png 78KB Dec 18 2014 03:15:24 PMvm64-127_1__sr320_-_VNC_Viewer_1A439789.png
Washington_Sea_Grant_1CE36F7A.pngWashington_Sea_Grant_1CE36F7A.png 26KB May 11 2016 06:47:40 AMWashington_Sea_Grant_1CE36F7A.png
Washington_Sea_Grant_1CE37044.pngWashington_Sea_Grant_1CE37044.png 142KB May 11 2016 06:51:00 AMWashington_Sea_Grant_1CE37044.png
Wednesday__Aug_21_-_Dropbox_17C6C322.pngWednesday__Aug_21_-_Dropbox_17C6C322.png 1049KB Aug 22 2013 03:15:16 PMWednesday__Aug_21_-_Dropbox_17C6C322.png
Welcome_to_NCBI_Batch_CD-search_17BE6F70.pngWelcome_to_NCBI_Batch_CD-search_17BE6F70... 124KB Aug 16 2013 07:39:44 AMWelcome_to_NCBI_Batch_CD-search_17BE6F70.png
Welcome_to_NCBI_Batch_CD-search_17BF16AE.pngWelcome_to_NCBI_Batch_CD-search_17BF16AE... 132KB Aug 16 2013 07:33:18 PMWelcome_to_NCBI_Batch_CD-search_17BF16AE.png
whale_1A5EFE41.pngwhale_1A5EFE41.png 40KB Jan 08 2015 10:04:57 AMwhale_1A5EFE41.png
WhenIsGood__DNR_Proteomics_Chat_Event_Results_1E98325A.pngWhenIsGood__DNR_Proteomics_Chat_Event_Re... 112KB Apr 07 2017 01:47:24 PMWhenIsGood__DNR_Proteomics_Chat_Event_Results_1E98325A.png
White_BS1511196_R2_barcodes_-_Google_Sheets_and_White_BS1511196_R2_barcodes_-_Google_Sheets_1C4FEC36.pngWhite_BS1511196_R2_barcodes_-_Google_She... 395KB Jan 20 2016 08:24:23 AMWhite_BS1511196_R2_barcodes_-_Google_Sheets_and_White_BS1511196_R2_barcodes_-_Google_Sheets_1C4FEC36.png
Whole_genome_BSseq_December_2015_·_RobertsLab_project-olympia_oyster-genomic_Wiki_1DAD4A4D.pngWhole_genome_BSseq_December_2015_·_Robe... 118KB Oct 11 2016 09:27:08 AMWhole_genome_BSseq_December_2015_·_RobertsLab_project-olympia_oyster-genomic_Wiki_1DAD4A4D.png
Whole_genome_BSseq_December_2015_·_RobertsLab_project-olympia_oyster-genomic_Wiki_1DAD4D68.pngWhole_genome_BSseq_December_2015_·_Robe... 61KB Oct 11 2016 09:40:17 AMWhole_genome_BSseq_December_2015_·_RobertsLab_project-olympia_oyster-genomic_Wiki_1DAD4D68.png
wid_18A6E357.pngwid_18A6E357.png 272KB Feb 08 2014 02:14:54 PMwid_18A6E357.png
Wild_juvenile_eastern_oysters_from_low_salinity_-_SRA_-_NCBI_1A8BCA4D.pngWild_juvenile_eastern_oysters_from_low_s... 74KB Feb 11 2015 09:35:09 AMWild_juvenile_eastern_oysters_from_low_salinity_-_SRA_-_NCBI_1A8BCA4D.png
Wild_juvenile_eastern_oysters__Crassostrea_virginica__from_high_sali____-_SRA_-_NCBI_1A8BCA89.pngWild_juvenile_eastern_oysters__Crassostr... 76KB Feb 11 2015 09:36:09 AMWild_juvenile_eastern_oysters__Crassostrea_virginica__from_high_sali____-_SRA_-_NCBI_1A8BCA89.png
working-directory_and_P_generosa__and_Live___TWiT_🔊_1E04B8A6.pngworking-directory_and_P_generosa__and_Li... 173KB Dec 16 2016 04:04:55 PMworking-directory_and_P_generosa__and_Live___TWiT_🔊_1E04B8A6.png
www_bioinformatics_nl_emboss-explorer_output_221496_outfile_1DDA5516.pngwww_bioinformatics_nl_emboss-explorer_ou... 336KB Nov 14 2016 12:24:58 PMwww_bioinformatics_nl_emboss-explorer_output_221496_outfile_1DDA5516.png
www_bioinformatics_nl_emboss-explorer_output_221496_outfile_1DDA5520.pngwww_bioinformatics_nl_emboss-explorer_ou... 336KB Nov 14 2016 12:25:05 PMwww_bioinformatics_nl_emboss-explorer_output_221496_outfile_1DDA5520.png
www_biomedcentral_com_-_Figure_1B42FF2A.pngwww_biomedcentral_com_-_Figure_1B42FF2A.png 217KB Jun 30 2015 09:45:31 AMwww_biomedcentral_com_-_Figure_1B42FF2A.png
www_epigentek_com_docs_P-1001_pdf_1A07DDD8.pngwww_epigentek_com_docs_P-1001_pdf_1A07DD... 37KB Nov 03 2014 07:59:22 AMwww_epigentek_com_docs_P-1001_pdf_1A07DDD8.png
www_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A00B7.pngwww_nature_com_nature_journal_v490_n7418... 83KB Dec 11 2014 08:41:29 AMwww_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A00B7.png
www_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A00EE.pngwww_nature_com_nature_journal_v490_n7418... 93KB Dec 11 2014 08:42:23 AMwww_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A00EE.png
www_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A007F.pngwww_nature_com_nature_journal_v490_n7418... 33KB Dec 11 2014 08:40:33 AMwww_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A007F.png
www_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A009F.pngwww_nature_com_nature_journal_v490_n7418... 142KB Dec 11 2014 08:41:05 AMwww_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A009F.png
www_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A01C2.pngwww_nature_com_nature_journal_v490_n7418... 29KB Dec 11 2014 08:45:56 AMwww_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A01C2.png
www_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A01EA.pngwww_nature_com_nature_journal_v490_n7418... 41KB Dec 11 2014 08:46:35 AMwww_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A01EA.png
www_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A011A.pngwww_nature_com_nature_journal_v490_n7418... 54KB Dec 11 2014 08:43:07 AMwww_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A011A.png
www_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A0135.pngwww_nature_com_nature_journal_v490_n7418... 111KB Dec 11 2014 08:43:35 AMwww_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A0135.png
www_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A014B.pngwww_nature_com_nature_journal_v490_n7418... 50KB Dec 11 2014 08:43:57 AMwww_nature_com_nature_journal_v490_n7418_extref_nature11413-s1_pdf_1A3A014B.png
XP_013075419_1__PREDICTED__DNA__cytosine-5_-methyltransferase_1-like__Biomphalaria_glabrata__1BD994A3.pngXP_013075419_1__PREDICTED__DNA__cytosine... 25KB Oct 22 2015 03:03:18 PMXP_013075419_1__PREDICTED__DNA__cytosine-5_-methyltransferase_1-like__Biomphalaria_glabrata__1BD994A3.png
Y38_control_GTGAAA_L005_R1_001_fastq_gz_FastQC_Report_18C7D045.pngY38_control_GTGAAA_L005_R1_001_fastq_gz_... 25KB Mar 05 2014 01:36:07 PMY38_control_GTGAAA_L005_R1_001_fastq_gz_FastQC_Report_18C7D045.png
Y54_Mix_GTGGCC_L005_R1_fastq_gz_FastQC_Report_18C7D07C.pngY54_Mix_GTGGCC_L005_R1_fastq_gz_FastQC_R... 25KB Mar 05 2014 01:37:01 PMY54_Mix_GTGGCC_L005_R1_fastq_gz_FastQC_Report_18C7D07C.png
yaaminiv-fish546-2016_2016-12-12-oly-gonad-OA-part7-REVIGO_ipynb_at_master_·_yaaminiv_yaaminiv-fish546-2016_1E0855D9.pngyaaminiv-fish546-2016_2016-12-12-oly-gon... 352KB Dec 19 2016 09:52:26 AMyaaminiv-fish546-2016_2016-12-12-oly-gonad-OA-part7-REVIGO_ipynb_at_master_·_yaaminiv_yaaminiv-fish546-2016_1E0855D9.png
yv_1E4B6C65.pngyv_1E4B6C65.png 498KB Feb 08 2017 07:10:29 AMyv_1E4B6C65.png
_1__Discovery_Environment_188B2E8C.png_1__Discovery_Environment_188B2E8C.png 119KB Jan 18 2014 01:51:09 PM_1__Discovery_Environment_188B2E8C.png
_3__Discovery_Environment_193E7736.png_3__Discovery_Environment_193E7736.png 25KB Jun 03 2014 02:35:52 PM_3__Discovery_Environment_193E7736.png
_3__Discovery_Environment_193E7754.png_3__Discovery_Environment_193E7754.png 25KB Jun 03 2014 02:36:21 PM_3__Discovery_Environment_193E7754.png
_5__Discovery_Environment_195CA4CE.png_5__Discovery_Environment_195CA4CE.png 42KB Jun 26 2014 11:58:24 AM_5__Discovery_Environment_195CA4CE.png
_14__Discovery_Environment_188DB212.png_14__Discovery_Environment_188DB212.png 124KB Jan 20 2014 11:36:55 AM_14__Discovery_Environment_188DB212.png
_16__Discovery_Environment_1A436B1C.png_16__Discovery_Environment_1A436B1C.png 50KB Dec 18 2014 12:05:50 PM_16__Discovery_Environment_1A436B1C.png
_18__Discovery_Environment_1A446EF5.png_18__Discovery_Environment_1A446EF5.png 44KB Dec 19 2014 06:34:27 AM_18__Discovery_Environment_1A446EF5.png
_20__Discovery_Environment_1A33CBAE.png_20__Discovery_Environment_1A33CBAE.png 42KB Dec 06 2014 03:41:36 PM_20__Discovery_Environment_1A33CBAE.png
_20__Discovery_Environment_1A33CC13.png_20__Discovery_Environment_1A33CC13.png 13KB Dec 06 2014 03:43:17 PM_20__Discovery_Environment_1A33CC13.png
_24__Discovery_Environment_18A7FD52.png_24__Discovery_Environment_18A7FD52.png 30KB Feb 09 2014 10:18:02 AM_24__Discovery_Environment_18A7FD52.png
_31__Discovery_Environment_195F79DC.png_31__Discovery_Environment_195F79DC.png 50KB Jun 28 2014 03:31:57 PM_31__Discovery_Environment_195F79DC.png
_33__Discovery_Environment_1A33CEE2.png_33__Discovery_Environment_1A33CEE2.png 28KB Dec 06 2014 03:55:17 PM_33__Discovery_Environment_1A33CEE2.png
_36__Discovery_Environment_19915C2C.png_36__Discovery_Environment_19915C2C.png 165KB Aug 05 2014 11:38:37 AM_36__Discovery_Environment_19915C2C.png
_38__Discovery_Environment_19645E4E.png_38__Discovery_Environment_19645E4E.png 47KB Jul 02 2014 08:35:50 AM_38__Discovery_Environment_19645E4E.png
_39__Discovery_Environment_1A462B43.png_39__Discovery_Environment_1A462B43.png 11KB Dec 20 2014 02:10:12 PM_39__Discovery_Environment_1A462B43.png
_39__Discovery_Environment_1A462B91.png_39__Discovery_Environment_1A462B91.png 11KB Dec 20 2014 02:11:29 PM_39__Discovery_Environment_1A462B91.png
_40__Discovery_Environment_1A33CF96.png_40__Discovery_Environment_1A33CF96.png 52KB Dec 06 2014 03:58:15 PM_40__Discovery_Environment_1A33CF96.png
_40__Discovery_Environment_1A33D0B2.png_40__Discovery_Environment_1A33D0B2.png 22KB Dec 06 2014 04:03:00 PM_40__Discovery_Environment_1A33D0B2.png
_40__Discovery_Environment_18BCD1C5.png_40__Discovery_Environment_18BCD1C5.png 36KB Feb 25 2014 05:27:37 AM_40__Discovery_Environment_18BCD1C5.png
_40__Discovery_Environment_18C93BFF.png_40__Discovery_Environment_18C93BFF.png 102KB Mar 06 2014 03:28:07 PM_40__Discovery_Environment_18C93BFF.png
_43__Discovery_Environment_1A33D446.png_43__Discovery_Environment_1A33D446.png 29KB Dec 06 2014 04:18:15 PM_43__Discovery_Environment_1A33D446.png
_43__Discovery_Environment_1A33D695.png_43__Discovery_Environment_1A33D695.png 29KB Dec 06 2014 04:28:07 PM_43__Discovery_Environment_1A33D695.png
_43__Discovery_Environment_18FC19DF.png_43__Discovery_Environment_18FC19DF.png 21KB Apr 14 2014 06:28:01 AM_43__Discovery_Environment_18FC19DF.png
_44__Discovery_Environment_🔊_1CEA6442.png_44__Discovery_Environment_🔊_1CEA6442... 42KB May 16 2016 01:25:41 PM_44__Discovery_Environment_🔊_1CEA6442.png
_46__Discovery_Environment_1A33D754.png_46__Discovery_Environment_1A33D754.png 22KB Dec 06 2014 04:31:18 PM_46__Discovery_Environment_1A33D754.png
_50__Discovery_Environment_1C66927C.png_50__Discovery_Environment_1C66927C.png 149KB Feb 06 2016 12:43:41 PM_50__Discovery_Environment_1C66927C.png
_54__Discovery_Environment_1A49E064.png_54__Discovery_Environment_1A49E064.png 44KB Dec 23 2014 09:39:50 AM_54__Discovery_Environment_1A49E064.png
_54__Discovery_Environment_1C8F3E99.png_54__Discovery_Environment_1C8F3E99.png 25KB Mar 08 2016 09:08:43 AM_54__Discovery_Environment_1C8F3E99.png
_56__Discovery_Environment_1A5EFB8C.png_56__Discovery_Environment_1A5EFB8C.png 24KB Jan 08 2015 09:53:17 AM_56__Discovery_Environment_1A5EFB8C.png
_56__Discovery_Environment_1A5EFBC8.png_56__Discovery_Environment_1A5EFBC8.png 155KB Jan 08 2015 09:54:17 AM_56__Discovery_Environment_1A5EFBC8.png
_56__Discovery_Environment_1A5EFDCA.png_56__Discovery_Environment_1A5EFDCA.png 209KB Jan 08 2015 10:02:56 AM_56__Discovery_Environment_1A5EFDCA.png
_56__Discovery_Environment_1A5F2084.png_56__Discovery_Environment_1A5F2084.png 56KB Jan 08 2015 12:31:00 PM_56__Discovery_Environment_1A5F2084.png
_56__Discovery_Environment_1B3467F5.png_56__Discovery_Environment_1B3467F5.png 51KB Jun 19 2015 08:08:35 AM_56__Discovery_Environment_1B3467F5.png
_56__Discovery_Environment_1B34687C.png_56__Discovery_Environment_1B34687C.png 14KB Jun 19 2015 08:10:49 AM_56__Discovery_Environment_1B34687C.png
_56__Discovery_Environment_1B346899.png_56__Discovery_Environment_1B346899.png 20KB Jun 19 2015 08:11:18 AM_56__Discovery_Environment_1B346899.png
_62__Discovery_Environment_1CA059D6.png_62__Discovery_Environment_1CA059D6.png 46KB Mar 21 2016 09:33:29 AM_62__Discovery_Environment_1CA059D6.png
_83__Discovery_Environment_1A642AD1.png_83__Discovery_Environment_1A642AD1.png 31KB Jan 12 2015 08:16:17 AM_83__Discovery_Environment_1A642AD1.png
_83__Discovery_Environment_1A642AF0.png_83__Discovery_Environment_1A642AF0.png 33KB Jan 12 2015 08:16:48 AM_83__Discovery_Environment_1A642AF0.png
_83__Discovery_Environment_1A642B05.png_83__Discovery_Environment_1A642B05.png 52KB Jan 12 2015 08:17:09 AM_83__Discovery_Environment_1A642B05.png
_86__Discovery_Environment_1DBFA6D9.png_86__Discovery_Environment_1DBFA6D9.png 61KB Oct 25 2016 07:42:47 AM_86__Discovery_Environment_1DBFA6D9.png
_86__Discovery_Environment_1DBFA700.png_86__Discovery_Environment_1DBFA700.png 32KB Oct 25 2016 07:43:17 AM_86__Discovery_Environment_1DBFA700.png
_89__Discovery_Environment_1E3D4DEB.png_89__Discovery_Environment_1E3D4DEB.png 231KB Jan 28 2017 02:08:46 PM_89__Discovery_Environment_1E3D4DEB.png
_94__Discovery_Environment_1CB98355.png_94__Discovery_Environment_1CB98355.png 90KB Apr 09 2016 11:37:11 AM_94__Discovery_Environment_1CB98355.png
_101__Discovery_Environment_1A817184.png_101__Discovery_Environment_1A817184.png 48KB Feb 03 2015 01:13:41 PM_101__Discovery_Environment_1A817184.png
_103__Discovery_Environment_1A34B118.png_103__Discovery_Environment_1A34B118.png 20KB Dec 07 2014 08:00:28 AM_103__Discovery_Environment_1A34B118.png
_109__Discovery_Environment_1A34B470.png_109__Discovery_Environment_1A34B470.png 32KB Dec 07 2014 08:14:47 AM_109__Discovery_Environment_1A34B470.png
_264__Discovery_Environment_17A1B77F.png_264__Discovery_Environment_17A1B77F.png 21KB Jul 25 2013 12:50:23 PM_264__Discovery_Environment_17A1B77F.png
_266__Discovery_Environment_17A1BD98.png_266__Discovery_Environment_17A1BD98.png 19KB Jul 25 2013 01:16:15 PM_266__Discovery_Environment_17A1BD98.png
_266__Discovery_Environment_17BBF393.png_266__Discovery_Environment_17BBF393.png 35KB Aug 14 2013 10:26:35 AM_266__Discovery_Environment_17BBF393.png
_270__Discovery_Environment_17BBF46B.png_270__Discovery_Environment_17BBF46B.png 47KB Aug 14 2013 10:30:12 AM_270__Discovery_Environment_17BBF46B.png
_Busy__02_5-Mapping-Oly-Reads_1DD62952.png_Busy__02_5-Mapping-Oly-Reads_1DD62952.png 245KB Nov 11 2016 08:29:06 AM_Busy__02_5-Mapping-Oly-Reads_1DD62952.png
_Master-SP-Gig-Ruphi_Dh_1D95DB9F.png_Master-SP-Gig-Ruphi_Dh_1D95DB9F.png 154KB Sep 23 2016 02:52:34 PM_Master-SP-Gig-Ruphi_Dh_1D95DB9F.png
_Master-SP-Gig-Ruphi_Dh_and_Geoduck-transcriptome_v3_bigtable_1DC0E546.png_Master-SP-Gig-Ruphi_Dh_and_Geoduck-tran... 483KB Oct 26 2016 06:21:12 AM_Master-SP-Gig-Ruphi_Dh_and_Geoduck-transcriptome_v3_bigtable_1DC0E546.png
_Master-SP-Gig-Ruphi_Dh_and_Geoduck-transcriptome_v3_bigtable_1DC0E556.png_Master-SP-Gig-Ruphi_Dh_and_Geoduck-tran... 483KB Oct 26 2016 06:21:28 AM_Master-SP-Gig-Ruphi_Dh_and_Geoduck-transcriptome_v3_bigtable_1DC0E556.png
_scratch_1A057230.png_scratch_1A057230.png 158KB Nov 01 2014 12:55:31 PM_scratch_1A057230.png
_scratch_and_rhiever_rmagic-tutorial_1891FCF7.png_scratch_and_rhiever_rmagic-tutorial_189... 28KB Jan 23 2014 05:45:45 PM_scratch_and_rhiever_rmagic-tutorial_1891FCF7.png
__in_UniProtKB_1D8B14B4.png__in_UniProtKB_1D8B14B4.png 212KB Sep 15 2016 10:41:10 AM__in_UniProtKB_1D8B14B4.png
__Photo_1A018A0C.png__Photo_1A018A0C.png 256KB Oct 29 2014 01:48:13 PM__Photo_1A018A0C.png
▶_Lodish_et_al_2000_Gene_Expression_-_YouTube_1A571D85.png▶_Lodish_et_al_2000_Gene_Expression_-_... 65KB Jan 02 2015 10:40:06 AM▶_Lodish_et_al_2000_Gene_Expression_-_YouTube_1A571D85.png
▶_Lodish_et_al_2000_Gene_Expression_-_YouTube_1A571DD3.png▶_Lodish_et_al_2000_Gene_Expression_-_... 65KB Jan 02 2015 10:41:24 AM▶_Lodish_et_al_2000_Gene_Expression_-_YouTube_1A571DD3.png
Directory Listing Script ©2008 Evoluted, Web Design Sheffield.