Jake Heare Research Central

October 2015 Goals

2015-10-01T09:52:00.000-07:00

It's the beginning of the month, so its time for GOOOOAAAAALLLLLLSSSSSSSS!!!!!

But first lets check in on last months goals.

September 2015 Goals

1.Complete Results, Chapter 2, Thesis

2. Sending Draft of thesis to committee (mid Sept)

3. Begin preparations for defense presentation

4. Find TAship/Start TAing

5. Attend PCSGA (Network, view other presentations, work on presentation)

6. Submit Chapter 1 to JSR

7. Go camping!

How I did:

1. DONE!

2. DONE!

3. DONE!

4. DONE!

5. DONE!

6. DONE! AND REJECTED!

7. DONE!

SO SUCCESSFUL!!!!

Awesome lets see if I can beat that high score with this months goals.

October 2015 Goals

1. Complete Defense Presentation

2. Practice Defense Presentation

3. DEFEND!

4. Work on thesis edits!

5. Work on Chapter 1 edits for resubmission!

6. Work on Chapter 2 edits for submission!

7. Turn 29!

8. Supply UW Bee Club with lots of beer!

9. Win Winter Warmer Competition!

Also if anyone is interested in watching my thesis defense it will be

Wednesday October 14th

12:00 PM PST

FSH 203

You can view a live stream of it here:

http://eagle.fish.washington.edu/jake/

9 1 2015 Mean Ct Value Stats and Graphs R script

2015-09-01T15:25:00.001-07:00

Steven has been helping me cull and curate the Ct values from the qPCR runs over the summer. He's developed a spreadsheet of mean Ct values of the good replicate runs. I've taken those values and created delta Ct values of the target over Actin. Then I log transformed the data to produce as normal data as possible. Finally I ran ANOVA and Tukey's Honest Significant Difference Post Hoc, on the log transformed data. Then created boxplots of the delta Ct values. I will create a table of the significant differences as a clear way to present the results. Below is the annotated code for the R script which I'll post a link to in the github repository at the bottom.

#Necessary Packages to manipulate data and plot values.
require(plyr)
require(ggplot2)
require(splitstackshape)

#Read in mean Ct value table
dCt<-read.csv("CTvalues83115.csv", header=T)
#Split SAMPLE_ID column to create columns for population, treatment, and sample number
dCt<-cSplit(dCt,"SAMPLE_ID", sep= "_", drop=F)
#rename columns appropriately
dCt<-rename(dCt,replace=c("SAMPLE_ID_1"="Pop","SAMPLE_ID_2"="Treat","SAMPLE_ID_3"="Sample"))

#divide each target of interest by the mean Ct value of the Actin Normalizing gene
dCt$CARM<-(dCt$CarmmeanCt/dCt$Actinmeanct)
dCt$TLR<-(dCt$TLRaverage/dCt$Actinmeanct)
dCt$CRAF<-(dCt$CRAFctaverage/dCt$Actinmeanct)
dCt$H2AV<-(dCt$H2AVavgct/dCt$Actinmeanct)
dCt$PGRP<-(dCt$PGRPaverage/dCt$Actinmeanct)
dCt$HSP70<-(dCt$HSP70averageCt/dCt$Actinmeanct)
dCt$BMP2<-(dCt$BMP2average/dCt$Actinmeanct)
dCt$GRB2<-(dCt$GRB2average/dCt$Actinmeanct)
dCt$PGEEP4<-(dCt$PGEEP4ctav/dCt$Actinmeanct)

#log transform the data to develop normality in data
dCt$CARMlog<-log(dCt$CARM)
dCt$TLRlog<-log(dCt$TLR)
dCt$H2AVlog<-log(dCt$H2AV)
dCt$PGRPlog<-log(dCt$PGRP)
dCt$HSP70log<-log(dCt$HSP70)
dCt$BMP2log<-log(dCt$BMP2)
dCt$GRB2log<-log(dCt$GRB2)
dCt$PGEEP4log<-log(dCt$PGEEP4)
dCt$CRAFlog<-log(dCt$CRAF)

#Run ANOVA's on all log transformed data as well as Tukey's Honestly Significant Difference post hoc test
CARM<-aov(CARMlog~Pop+Treat+Pop:Treat, data=dCt)
CARM
TukeyHSD(CARM)

TLR<-aov(TLRlog~Pop+Treat+Pop:Treat, data=dCt)
TLR
TukeyHSD(TLR)

H2AV<-aov(H2AVlog~Pop+Treat+Pop:Treat, data=dCt)
H2AV
TukeyHSD(H2AV)

PGRP<-aov(PGRPlog~Pop+Treat+Pop:Treat, data=dCt)
PGRP
TukeyHSD(PGRP)

HSP70<-aov(HSP70log~Pop+Treat+Pop:Treat, data=dCt)
HSP70
TukeyHSD(HSP70)

BMP2<-aov(BMP2log~Pop+Treat+Pop:Treat, data=dCt)
BMP2
TukeyHSD(BMP2)

GRB2<-aov(GRB2log~Pop+Treat+Pop:Treat, data=dCt)
GRB2
TukeyHSD(GRB2)

PGEEP4<-aov(PGEEP4log~Pop+Treat+Pop:Treat, data=dCt)
PGEEP4
TukeyHSD(PGEEP4)

CRAF<-aov(CRAFlog~Pop+Treat+Pop:Treat, data=dCt)
CRAF
TukeyHSD(CRAF)

#graph all raw mean Ct values to produce boxplots to visualize data

ggplot(data=dCt)+geom_boxplot(aes(x=Treat, y=CARM,fill=Pop))+theme_bw()+
theme(axis.text.x=element_text(size=20), axis.text.y=element_text(size=20),
axis.title.x=element_text(size=25), axis.title.y=element_text(size=25),
legend.position=c(.1,.1),panel.grid.major=element_blank())+
labs(x="Treatment", y="target/actin delta Ct")

ggplot(data=dCt)+geom_boxplot(aes(x=Treat, y=TLR, fill=Pop))+theme_bw()+
theme(axis.text.x=element_text(size=20), axis.text.y=element_text(size=20),
axis.title.x=element_text(size=25), axis.title.y=element_text(size=25),
legend.position=c(.1,.1),panel.grid.major=element_blank())+
labs(x="Treatment", y="target/actin delta Ct")

ggplot(data=dCt)+geom_boxplot(aes(x=Treat, y=H2AV,fill=Pop))+theme_bw()+
theme(axis.text.x=element_text(size=20), axis.text.y=element_text(size=20),
axis.title.x=element_text(size=25), axis.title.y=element_text(size=25),
legend.position=c(.1,.1),panel.grid.major=element_blank())+
labs(x="Treatment", y="target/actin delta Ct")

ggplot(data=dCt)+geom_boxplot(aes(x=Treat, y=PGRP,fill=Pop))+theme_bw()+
theme(axis.text.x=element_text(size=20), axis.text.y=element_text(size=20),
axis.title.x=element_text(size=25), axis.title.y=element_text(size=25),
legend.position=c(.1,.1),panel.grid.major=element_blank())+
labs(x="Treatment", y="target/actin delta Ct")

ggplot(data=dCt)+geom_boxplot(aes(x=Treat, y=HSP70,fill=Pop))+theme_bw()+
theme(axis.text.x=element_text(size=20), axis.text.y=element_text(size=20),
axis.title.x=element_text(size=25), axis.title.y=element_text(size=25),
legend.position=c(.1,.1),panel.grid.major=element_blank())+
labs(x="Treatment", y="target/actin delta Ct")

ggplot(data=dCt)+geom_boxplot(aes(x=Treat, y=BMP2,fill=Pop))+theme_bw()+
theme(axis.text.x=element_text(size=20), axis.text.y=element_text(size=20),
axis.title.x=element_text(size=25), axis.title.y=element_text(size=25),
legend.position=c(.1,.1),panel.grid.major=element_blank())+
labs(x="Treatment", y="target/actin delta Ct")

ggplot(data=dCt)+geom_boxplot(aes(x=Treat, y=GRB2,fill=Pop))+theme_bw()+
theme(axis.text.x=element_text(size=20), axis.text.y=element_text(size=20),
axis.title.x=element_text(size=25), axis.title.y=element_text(size=25),
legend.position=c(.1,.1),panel.grid.major=element_blank())+
labs(x="Treatment", y="target/actin delta Ct")

ggplot(data=dCt)+geom_boxplot(aes(x=Treat, y=PGEEP4,fill=Pop))+theme_bw()+
theme(axis.text.x=element_text(size=20), axis.text.y=element_text(size=20),
axis.title.x=element_text(size=25), axis.title.y=element_text(size=25),
legend.position=c(.1,.1),panel.grid.major=element_blank())+
labs(x="Treatment", y="target/actin delta Ct")

ggplot(data=dCt)+geom_boxplot(aes(x=Treat, y=CRAF,fill=Pop))+theme_bw()+
theme(axis.text.x=element_text(size=20), axis.text.y=element_text(size=20),
axis.title.x=element_text(size=25), axis.title.y=element_text(size=25),
legend.position=c(.1,.1),panel.grid.major=element_blank())+
labs(x="Treatment", y="target/actin delta Ct")

Graphs produced

Significant Differences Table

	CARMlog	TLRlog	H2AVlog	PGRPlog	HSP70log	BMP2log	GRB2log	PGEEP4log	CRAFlog
Overall
C:T			X	X	X
C:M	X	X							X
T:M	X	X	X	X	X
N:H		X
H:S		X
S:N							X
Control
N:H
H:S
S:N
Temperature
N:H
H:S
S:N
Mechanical
N:H
H:S
S:N							X
Control:Temp
N
H
S			X
Control:Mech
N
H
S						X	X
Temp:Mech
N
H
S	X			X	X

You can find the raw mean Ct values here and the R script here.

September 2015 Goals

2015-09-01T09:18:00.001-07:00

Its September 1st, Time for GOALLLLLLLLSSSSSSSSS!!!!! Let's take a quick look at the goals for last month and what I accomplished of them.

August 2015 Goals

1.Complete Analysis of qPCR data

2. Write Results

3. Complete Chapter 2

4. Complete Thesis

5. Schedule New Defense Date

6. Get TA position for the fall

7. Drink some delicious Flying Bike beer.

How I did:

1. I'm really close. We've got most if not all of the qPCR data that we're going to use for chapter 2. I have written an R script to run through the average Ct data and produce statistics and graphs for it. I'm tidying it up today so I can basically say this one is done.

2. This will be done in the next two weeks now that the Analysis is basically done.

3. This will be done in the next two weeks.

4. See 2 & 3.

5. New Defense date is October 14th at 11 am.

6. Still trying to find one. Waiting to hear about the Intro R TAship.

7. The brewery opened and the beer is delicious!

September 2015 Goals

1.Complete Results, Chapter 2, Thesis

2. Sending Draft of thesis to committee (mid Sept)

3. Begin preparations for defense presentation

4. Find TAship/Start TAing

5. Attend PCSGA (Network, view other presentations, work on presentation)

6. Submit Chapter 1 to JSR

7. Go camping!

8 26 2015 28s CTM qPCR 2

2015-08-26T18:35:00.001-07:00

Today I ran two reps of the 28s target, one on the opticon and one at the CFX. We may use this as a normalizing gene if the reads look consistent. This is the run on the CFX.

Primers:

1702	28s_3_FWD	TAAGGCCAGTGTGGGAGAGA	JH	8/12/2015	20	55	59.88	O.lurida	"28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)"	Q5REJ1
1701	28s_3_REV	CGCCTCACTTTTTGTGCCTC	JH	8/12/2015	20	55	60.04	O.lurida	"28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)"	Q5REJ1

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
PCR H2O	5	400
1:9 cDNA	4

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9	10
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

NTCs

The amplification and melt curves look good. There's some minor primer dimer in one of the NTCs but its nothing to be concerned about.

You can find the raw ct values here and the raw data file here.

8 26 2015 28s CTM qPCR 1

2015-08-26T18:16:00.002-07:00

Today I ran two reps of the 28s target, one on the opticon and one at the CFX. We may use this as a normalizing gene if the reads look consistent. This is the run on the opticon.

Primers:

1702	28s_3_FWD	TAAGGCCAGTGTGGGAGAGA	JH	8/12/2015	20	55	59.88	O.lurida	"28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)"	Q5REJ1
1701	28s_3_REV	CGCCTCACTTTTTGTGCCTC	JH	8/12/2015	20	55	60.04	O.lurida	"28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)"	Q5REJ1

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
PCR H2O	5	400
1:9 cDNA	4

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9	10
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

Amplification

Melt Curve

NTCs

Amplification

Melt Curve

The amplification and melt curves look good. There's some minor amplification in the NTCs but it appears to be a random product larger than the target so there's no worry about it.

You can find the raw ct value data here and the raw data here.

8 18 2015 18s/28s primer check qPCR

2015-08-19T11:35:00.000-07:00

While looking for new normalizing primers to add to the EF1d and actin that I already have I've developed primers for 18s and 28s. The 18s are based on sequences for Ostrea conchaphila. The 28s primer is developed from the 28s sequence from the O.lurida Transcriptome version 3. I tested these primers on the mechanical stress samples in a 1:9 dilution.

Primers:

1702	28s_3_FWD	TAAGGCCAGTGTGGGAGAGA	JH	8/12/2015	20	55	59.88	O.lurida	"28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)"	Q5REJ1
1701	28s_3_REV	CGCCTCACTTTTTGTGCCTC	JH	8/12/2015	20	55	60.04	O.lurida	"28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)"	Q5REJ1
1700	18s_2_FWD	CTCGATTCCCTTTCCCCCAC	JH	8/12/2015	20	60	60.11	O.conchaphila	18s Ribosomal RNA	EF035117.1
1699	18s_2_REV	GCCCGATCTCTTTCCACCTC	JH	8/12/2015	20	60	60.18	O.conchaphila	18s Ribosomal RNA	EF035117.1
1698	18s_1_FWD	TTCCTTTTCCCCCACTCAGC	JH	8/12/2015	20	55	59.89	O.conchaphila	18s Ribosomal RNA	EF035118.1
1697	18s_1_REV	CGCTTCACTCGCCGTTACTA	JH	8/12/2015	20	55	60.18	O.conchaphila	18s Ribosomal RNA	EF035118.1

Reagent Table:

	Volume	Reactions X10
Ssofast Evagreen MM	10	100
FWD Primer	0.5	5
REV Primer	0.5	5
PCR H2O	5	50
1:9 cDNA	4

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 16 ul Master Mix to each tube
Pipetted 4 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Table Layout:

18s_1	18s_2	28s_3
1	2	3	4	5
DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	18s_1_NTC	18s_1_NTC
DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	18s_2_NTC	18s_2_NTC
DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	28s_3_NTC	28s_3_NTC
DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4
DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

18s_1

All

NTC

18s_2

All

NTC

28s_3

All

NTC

The 18s primers each have issues. The first has seemingly random amplification and poor melt curves. The second seems to autoamplify and has NTCs with amplification equal to the samples.

The 28s primer looks great. It has strong amplification with only primer dimers appearing in the NTCs. I think this should be used for the next normalizing primers.

8 18 2015 EF1d CTM2 reps qPCR

2015-08-19T11:04:00.001-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran EF1d. To save on cDNA I stopped running full replicates of the Control and Temperature samples with the mech stress samples. I run partials made up of 8 samples for Control and 8 of Heat.

Primers:

1682	EF1d_FWD	GAACTGCCCACTGATTTGCC	JH	7/22/2015	20	55	60	O.lurida	Elongation factor 1-delta (EF-1-delta)	A5D989
1681	EF1d_REV	TGTGGGGTGAAACACGTTGA	JH	7/22/2015	20	50	60	O.lurida	Elongation factor 1-delta (EF-1-delta)	A5D989

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9
DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 HC1	DNased 42215 HT1 1	NTC
DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 HC2	DNased 42215 HT1 2	NTC
DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 HC3	DNased 42215 HT1 3	NTC
DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 HC4	DNased 42215 HT1 4	NTC
DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 HC5	DNased 42215 HT1 5
DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 HC6	DNased 42215 HT1 6
DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 HC7	DNased 42215 HT1 7
DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 HC8	DNased 42215 HT1 8

All

Amplification

Melt Curve

NTCs

Amplification

Melt Curve

The amplification and melt curves look great. There is no appreciable amplification in the NTCs.

You can see the raw ct values here and the raw data file here.

8 18 2015 CARM CTM2 reps qPCR

2015-08-18T17:06:00.003-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran CARM. To save on cDNA I stopped running full replicates of the Control and Temperature samples with the mech stress samples. I run partials made up of 8 samples for Control and 8 of Heat.

Primers:

1642	CARM1_FWD	TGGTTATCAACAGCCCCGAC	JH	5/21/2015	20	55		O.lurida	Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)	Q6DC04
1641	CARM1_REV	GTTGTTGACCCCAGGAGGAG	JH	5/21/2015	20	55		O.lurida	Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)	Q6DC04

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9
DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 SC1	DNased 42215 ST1 1	NTC
DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 SC2	DNased 42215 ST1 2	NTC
DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 SC3	DNased 42215 ST1 3	NTC
DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 SC4	DNased 42215 ST1 4	NTC
DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 SC5	DNased 42215 ST1 5
DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 SC6	DNased 42215 ST1 6
DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 SC7	DNased 42215 ST1 7
DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 SC8	DNased 42215 ST1 8

All

Amplification

Melt Curves

NTCs

Amplification

Melt Curves

The amplification and melt curves look great, definitely better than the failure on saturday.

You can see the raw ct values here and the raw data file here.

8 15 2015 CRAF CTM2 reps qPCR

2015-08-17T10:54:00.000-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran CRAF To save on cDNA I stopped running full replicates of the Control and Temperature samples with the mech stress samples. I run partials made up of 8 samples for Control and 8 of Heat.

Primers:

1636	CRAF1_FWD	AGCAGGGCATCAAACTCTCC	JH	5/21/2015	20	55		O.lurida	TNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN)	Q60803
1635	CRAF1_REV	ACAAGTCGCACTGGCTACAA	JH	5/21/2015	20	55		O.lurida	TNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN)	Q60803

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9
DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 NC1	DNased 42215 NT1 1	NTC
DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 NC2	DNased 42215 NT1 2	NTC
DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 NC3	DNased 42215 NT1 3	NTC
DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 NC4	DNased 42215 NT1 4	NTC
DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 NC5	DNased 42215 NT1 5
DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 NC6	DNased 42215 NT1 6
DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 NC7	DNased 42215 NT1 7
DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 NC8	DNased 42215 NT1 8

All

Amplification

Melt Curve

NTCs

Amplification

Melt Curve

The amplification and melt curves look good. There's no appreciable amplification in the NTCs.

You can see the raw ct values here and raw data here.

8 15 2015 PGRP CTM2 reps qPCR

2015-08-15T20:40:00.003-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran PGRP. To save on cDNA I stopped running full replicates of the Control and Temperature samples with the mech stress samples. I run partials made up of 8 samples for Control and 8 of Heat.

Primers:

1632	PGRP-S_FWD	GAGACTTCACCTCGCACCAA	JH	5/21/2015	20	55		O.lurida	Peptidoglycan recognition protein 1 (Peptidoglycan recognition protein short) (PGRP-S)	O75594
1631	PGRP-S_REV	AACTGGTTTGCCCGACATCA	JH	5/21/2015	20	55		O.lurida	Peptidoglycan recognition protein 1 (Peptidoglycan recognition protein short) (PGRP-S)	O75594

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9
DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 HC1	DNased 42215 HT1 1	NTC
DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 HC2	DNased 42215 HT1 2	NTC
DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 HC3	DNased 42215 HT1 3	NTC
DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 HC4	DNased 42215 HT1 4	NTC
DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 HC5	DNased 42215 HT1 5
DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 HC6	DNased 42215 HT1 6
DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 HC7	DNased 42215 HT1 7
DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 HC8	DNased 42215 HT1 8

All

NTCs

The amplification and melt curves look good. There's no appreciable amplification in the NTCs and this bump is just noise.

You can see the raw ct values here and the raw data file here.

8 15 2015 H2AV CTM2 reps qPCR

2015-08-15T20:23:00.003-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran H2AV. To save on cDNA I stopped running full replicates of the Control and Temperature samples with the mech stress samples. I run partials made up of 8 samples for Control and 8 of Heat.

Primers:

1608	H2A.V_FWD	TGCTTTCTGTGTGCCCTTCT	JH	5/21/2015	20	55		O.lurida	Histone H2A.V (H2A.F/Z) (Fragment)	P08991
1607	H2A.V_REV	TATCACACCCCGTCACTTGC	JH	5/21/2015	20	55		O.lurida	Histone H2A.V (H2A.F/Z) (Fragment)	P08991

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9
DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 SC1	DNased 42215 ST1 1	NTC
DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 SC2	DNased 42215 ST1 2	NTC
DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 SC3	DNased 42215 ST1 3	NTC
DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 SC4	DNased 42215 ST1 4	NTC
DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 SC5	DNased 42215 ST1 5
DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 SC6	DNased 42215 ST1 6
DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 SC7	DNased 42215 ST1 7
DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 SC8	DNased 42215 ST1 8

All

Amplification

Melt Curve

NTCs

Amplification

Melt Curve

The amplification and melt curves look good. There's no appreciable amplification in the NTCs.

You can see the raw ct values here and the raw data file here.

8 15 2015 CARM CTM2 reps qPCR

2015-08-15T18:26:00.002-07:00

1642	CARM1_FWD	TGGTTATCAACAGCCCCGAC	JH	5/21/2015	20	55		O.lurida	Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)	Q6DC04
1641	CARM1_REV	GTTGTTGACCCCAGGAGGAG	JH	5/21/2015	20	55		O.lurida	Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)	Q6DC04

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9
DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 HC1	DNased 42215 HT1 1	NTC
DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 HC2	DNased 42215 HT1 2	NTC
DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 HC3	DNased 42215 HT1 3	NTC
DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 HC4	DNased 42215 HT1 4	NTC
DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 HC5	DNased 42215 HT1 5
DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 HC6	DNased 42215 HT1 6
DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 HC7	DNased 42215 HT1 7
DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 HC8	DNased 42215 HT1 8

All

NTCs

This qPCR failed entirely. I'm assuming I screwed up the master mix somehow. Probably by not adding one of the two primers. I'm going to make fresh primer working stock and rerun this qPCR next week.

You can see the raw data file here.

8 15 2015 Actin CTM2 reps qPCR

2015-08-15T18:16:00.001-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran Actin. To save on cDNA I stopped running full replicates of the Control and Temperature samples with the mech stress samples. I run partials made up of 8 samples for Control and 8 of Heat.

Primers:

1505	Ol_Act_F	GACCAGCCAAATCCAGACGA	BC	6/13/2012	20	55	60	O.lurida	Actin, adductor muscle
1504	Ol_Act_R	CGGTCGTACCACTGGTATCG		6/13/2012	20	60	60	O.lurida	Actin, adductor muscle

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9
DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 NC1	DNased 42215 NT1 1	NTC
DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 NC2	DNased 42215 NT1 2	NTC
DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 NC3	DNased 42215 NT1 3	NTC
DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 NC4	DNased 42215 NT1 4	NTC
DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 NC5	DNased 42215 NT1 5
DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 NC6	DNased 42215 NT1 6
DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 NC7	DNased 42215 NT1 7
DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 NC8	DNased 42215 NT1 8

All

Amplification

Melt Curve

NTCs

Amplification

Melt Curve

The amplification curves look good but the melt curve has a double bump which looks terrible. I'm not sure why this happened. It appears in all the samples.

You can see the raw ct values here and the raw data here.

8 14 2015 TLR CTM reps qPCR 2

2015-08-15T17:37:00.003-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran TLR2.1.

Primers:

1630	TLR2.1_FWD	ACAAAGATTCCACCCGGCAA	JH	5/21/2015	20	55		O.lurida	Toll-like receptor 2 type-1	Q9DD78
1629	TLR2.1_REV	ACACCAACGACAGGAAGTGG	JH	5/21/2015	20	55		O.lurida	Toll-like receptor 2 type-1	Q9DD78

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9	10
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

NTCs

The amplification curves look good. there's some minor amplification in the NTCs but its not appreciable compared to the samples. The melt curve for it falls in an odd place so I'm not sure what to make of it.

You can see the raw ct values here and the raw data here.

8 14 2015 TLR CTM reps qPCR

2015-08-15T17:24:00.003-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran TLR2.1.

Primers:

1630	TLR2.1_FWD	ACAAAGATTCCACCCGGCAA	JH	5/21/2015	20	55		O.lurida	Toll-like receptor 2 type-1	Q9DD78
1629	TLR2.1_REV	ACACCAACGACAGGAAGTGG	JH	5/21/2015	20	55		O.lurida	Toll-like receptor 2 type-1	Q9DD78

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9	10
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

Amplification

Melt Curve

NTCs

Amplification

Melt Curve

The amplification and melt curves look good. There's no appreciable amplification in the NTCs.

You can see the raw ct values here and the raw data here.

8 14 2015 BMP2 CTM reps qPCR 2

2015-08-14T21:31:00.001-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran BMP2.

Primers:

1640	BMP-2_FWD	TGAAGGAACGACCAAAGCCA	JH	5/21/2015	20	55		O.lurida	Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)	P12643
1639	BMP-2_REV	TCCGGTTGAAGAACCTCGTG	JH	5/21/2015	20	55		O.lurida	Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)	P12643

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9	10
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

NTCs

The amplification curves look great but the melt curves have the bump that always shows up. The NTCs have no appreciable amplification when compared to the samples.

You can see the raw ct values here and the raw data file here.

8 14 2015 BMP2 CTM reps qPCR

2015-08-14T21:17:00.001-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran BMP2.

Primers:

1640	BMP-2_FWD	TGAAGGAACGACCAAAGCCA	JH	5/21/2015	20	55		O.lurida	Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)	P12643
1639	BMP-2_REV	TCCGGTTGAAGAACCTCGTG	JH	5/21/2015	20	55		O.lurida	Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)	P12643

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9	10
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

Amplification

Melt Curve

NTCs

Amplification

Melt Curve

The amplification curves look good but the ever present bump in the melt curve is still there. BMP2 may not be strong enough to hold weight.

You can see the raw Ct values here and the raw data here.

8 14 2015 GRB2 CTM reps qPCR 2

2015-08-14T18:58:00.000-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran GRB2.

Primers:

1612	GRB2_FWD	AACTTTGTCCACCCAGACGG	JH	5/21/2015	20	55		O.lurida	Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2)	P62994
1611	GRB2_REV	CCAGTTGCAGTCCACTTCCT	JH	5/21/2015	20	55		O.lurida	Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2)	P62994

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9	10
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

NTCs

The amplification curves look good but theres still a little bet of a weird hump in the melt curves. I'm not sure whats going on with this primer. I should re run these with fresh primers just incase.

You can see the raw ct values here and the raw data file here.

8 14 2015 GRB2 CTM reps qPCR

2015-08-14T18:38:00.002-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran GRB2.

Primers:

1612	GRB2_FWD	AACTTTGTCCACCCAGACGG	JH	5/21/2015	20	55		O.lurida	Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2)	P62994
1611	GRB2_REV	CCAGTTGCAGTCCACTTCCT	JH	5/21/2015	20	55		O.lurida	Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2)	P62994

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9	10
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

Amplification

Melt Curve

NTCs

Amplification

Melt Curve

The amplification curves look good but the melt curve is troubling. I've never seen GRB2 have this double hump on its samples. The NTCS don't show any appreciable amplification.

You can see the raw Ct values here and the raw data file here.

8 13 2015 PGEEP4 CTM reps qPCR 2

2015-08-14T18:12:00.002-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran PGE/EP4.

Primers:

1638	PGE/EP4_FWD	ACAGCGACGGACGATTTTCT	JH	5/21/2015	20	55		O.lurida	Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)	P32240
1637	PGE/EP4_REV	ATGGCAGACGTTACCCAACA	JH	5/21/2015	20	55		O.lurida	Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)	P32240

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9	10
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

Amplification

Melt Curve

NTCs

Amplification

Melt Curve

The amplification and melt curves look good. There's no appreciable amplification in the NTCs compared to the samples.

You can see the raw Ct values here and the raw data file here.

8 13 2015 PGEEP4 CTM reps qPCR

2015-08-14T17:54:00.002-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran PGE/EP4.

Primers:

1638	PGE/EP4_FWD	ACAGCGACGGACGATTTTCT	JH	5/21/2015	20	55		O.lurida	Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)	P32240
1637	PGE/EP4_REV	ATGGCAGACGTTACCCAACA	JH	5/21/2015	20	55		O.lurida	Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)	P32240

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9	10
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

Amplification

Melt Curve

NTCs

Amplification

Melt Curve

The amplification and melt curves look good. The NTCs have no appreciable amplification when compared to the samples.

You can see the raw ct values here and the raw data file here.

8 13 2015 HSP70 CTM reps qPCR 2

2015-08-14T17:34:00.001-07:00

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran HSP70.

Primers:
HSP70
FWD - TTGTCGCCATTTTCCTCGCT
REV - GTTCCGATTTGTTCCGTGCC

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9	10
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

Amplification

Melt Curve

NTCs

Amplification

Melt Curve

The amplification and melt curves look good. There is some minor garbage in the NTCs but its negligible.

You can see the raw Ct values here and the raw data file here.

8 12 2015 HSP70 CTM reps qPCR

2015-08-14T17:06:00.000-07:00

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9	10
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

Amplification

Melt Curve

NTCs

Amplification

Melt Curve

The amplification and melt curves look good. There's some minor noise in the NTCs but its just garbage amplification.

You can find the raw Ct values from the Opticon here and the raw data file here.

8 10 2015 EF1d Mech Stress 2 rep qPCR

2015-08-11T15:52:00.000-07:00

Today I ran mechanical stress samples in replicates of two to generate data about expression values. Here I ran EF1d . I ran NTCs on a separate plate using the same reaction volume and 9 ul of PCR water.

Primers:

1682	EF1d_FWD	GAACTGCCCACTGATTTGCC	JH	7/22/2015	20	55	60	O.lurida	Elongation factor 1-delta (EF-1-delta)	A5D989
1681	EF1d_REV	TGTGGGGTGAAACACGTTGA	JH	7/22/2015	20	50	60	O.lurida	Elongation factor 1-delta (EF-1-delta)	A5D989

Reagent Table:

	Volume	Reactions X58
Ssofast Evagreen MM	10	580
FWD Primer	0.5	29
REV Primer	0.5	29
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

Rep 1	Rep 1	Rep 1	Rep 2	Rep 2	Rep 2
7	8	9	10	11	12
DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1
DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2
DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3
DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4
DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

Amplification

Melt Curve

NTC

Amplification

Melt Curve

The amplification and melt curves look good. There's nothing in the NTCs. I added the replicates to the comparison spreadsheet. You can see the absolute value difference between the replicates.

Rep Diff	Well / Set


0.48	H_M_1
4.08	N_M_1
2.83	S_M_1
0.37	H_M_2
2.94	N_M_2
2.29	S_M_2
0.85	H_M_3
2.67	N_M_3
1.51	S_M_3
1.13	H_M_4
3.12	N_M_4
2.12	S_M_4
0.26	H_M_5
2.82	N_M_5
1.37	S_M_5
1.18	H_M_6
2.81	N_M_6
0.17	S_M_6
1.52	H_M_7
4.33	N_M_7
0.76	S_M_7
2.21	H_M_8
4.42	N_M_8
0.79	S_M_8

There are 17 samples with a greater than 1 ct difference. This entire run needs to be re run to improve replicates

You can see the raw sample data here and NTC here.

8 10 2015 BMP2 Mech Stress 2 rep qPCR

2015-08-11T15:36:00.002-07:00

Today I ran mechanical stress samples in replicates of two to generate data about expression values. Here I ran BMP2 . I ran NTCs on a separate plate using the same reaction volume and 9 ul of PCR water.

Primers:

1640	BMP-2_FWD	TGAAGGAACGACCAAAGCCA	JH	5/21/2015	20	55		O.lurida	Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)	P12643
1639	BMP-2_REV	TCCGGTTGAAGAACCTCGTG	JH	5/21/2015	20	55		O.lurida	Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)	P12643

Reagent Table:

	Volume	Reactions X58
Ssofast Evagreen MM	10	580
FWD Primer	0.5	29
REV Primer	0.5	29
1:9 cDNA	9

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

Rep 1	Rep 1	Rep 1	Rep 2	Rep 2	Rep 2
1	2	3	4	5	6
DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1
DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2
DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3
DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4
DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All

Amplification

Melt Curve

NTC

Amplification

Melt Curve

The amplification and melt curves look good. There's nothing in the NTCs. I added the replicate Ct values from the opticon to the spreadsheet. You can see the replicate differences below.

Rep Diff	Well / Set


2.02	H_M_1
1.13	N_M_1
4.13	S_M_1
1.56	H_M_2
1.57	N_M_2
4.76	S_M_2
1.68	H_M_3
1.5	N_M_3
4.58	S_M_3
1.93	H_M_4
0.33	N_M_4
3.53	S_M_4
1.84	H_M_5
0.92	N_M_5
2.72	S_M_5
1.49	H_M_6
0.31	N_M_6
4.19	S_M_6
1.19	H_M_7
0.54	N_M_7
3.86	S_M_7
2.04	H_M_8
3.19	N_M_8
4.42	S_M_8

19 out of the 24 samples have a difference greater than 1 ct. All of these samples need to be re run to improve replicate performance.

You can see the raw sample data here and NTC here.