Jake Heare Research Central

Wednesday, June 24, 2015

6 24 2015 PCR Miner with Friedman lab data

After running the qPCRs in the Friedman lab yesterday, I have run them through PCR miner. I then took the results and normalized the expression values of TLR2.1. I'll go through the steps here.

First I need to export the data from BioRad CFX manager.

Click Export
Go to Export All Data Sheets
Select CSV as export file type

This causes a ton of CSV's to be produced most of them have absolutely no value for PCR Miner. The one we need is titled: Quantification Amplification Results _ FAM. FAM denotes the luminescence frequency which picked up the lumination from the SYBR green dye.

Now we need to format this file.

Rename each column with the appropriate Gene, Replicate, and sample Number.

Now you just need to copy the data into the entry area of PCR Miner.

PCR Miner pops out the data which you will download from the following screen:

Then this text file can be opened in Excel. Once in excel I highlighted the Cycle threshold value and the efficiency for each population. Then I created the expression value with the equation =1/(1+Efficiency)^CycleThreshold. I did this with both the TLR2.1 and Actin genes. Finally I divided the TLR2.1 expression values by the Actin expression values to get the normalized expression value of TLR2.1.

This is just the first full run using 8 samples per population per treatment but we can see some interesting trends. Expression of TLR2.1 is nearly doubled in the Fidalgo population (N) and tripled in the Oyster Bay population (S) due to Heat Stress. The values for the Dabob population are a little dubious due to the lack of expression from about half the population. Though it does show that while expression seems to be down regulated, it is roughly the same between control and treatment.

You can see the raw fluoresence file here, the PCR Miner output here, and my analyzed excel file here.

6 23 2015 Actin qPCR 2

Yesterday I re ran the Actin qPCR to create a normalizing reference for the Friedman Lab's qPCR Machine.

Primers:

1505	Ol_Act_F	GACCAGCCAAATCCAGACGA	BC	6/13/2012	20	55	60	O.lurida	Actin, adductor muscle
1504	Ol_Act_R	CGGTCGTACCACTGGTATCG		6/13/2012	20	60	60	O.lurida	Actin, adductor muscle

Reagent Table:

	Volume	Reactions X58
Ssofast Evagreen MM	10	580
FWD Primer	0.5	29
REV Primer	0.5	29
Nuclease Free H2O	8	464
cDNA	1

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 19 ul Master Mix to each tube
Pipetted appropriate cDNA sample to each tube
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

NTCs

The actin primer showed relatively equal expression across samples which is what we expected since we're using a properly calibrated machine. There were no miss expression values for samples which means it was expressed in all populations. I ran this and the TLR2.1 Data through PCR Miner to analyze expression. I will talk about that in my next post.

You can find the raw data file here.

6 23 2015 TLR2.1 qPCR

Yesterday after discovering that the Opticon was acting up, I decided to run a couple qPCR's on the Biorad CFX in the Friedman lab. The first was the TLR2.1 gene which had not been present in the Dabob population during the initial primer checks.

Primer:

1630	TLR2.1_FWD	ACAAAGATTCCACCCGGCAA	JH	5/21/2015	20	55		O.lurida	Toll-like receptor 2 type-1	Q9DD78
1629	TLR2.1_REV	ACACCAACGACAGGAAGTGG	JH	5/21/2015	20	55		O.lurida	Toll-like receptor 2 type-1	Q9DD78

Reagent Table:

	Volume	Reactions X58
Ssofast Evagreen MM	10	580
FWD Primer	0.5	29
REV Primer	0.5	29
Nuclease Free H2O	8	464
cDNA	1

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 19 ul Master Mix to each tube
Pipetted appropriate cDNA sample to each tube
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All Samples

NTCs

So the graph doesn't really do justice for the results. There is amplification in a majority of samples but interestingly only about half of the Dabob population shows expression of this allele. The other half show absolutely no expression. There are a few individuals which show a very low expression of this allele but others show some of the highest expression. Overall this is pretty confusing and may be indicative that the Dabob population is more heterogeneous for this allele than the other populations. After running this qPCR, I ran another Actin qPCR using the friedman machine to create a normalizing standard which I will talk about in my next post.

You can view the raw data here.

Tuesday, June 23, 2015

6 23 2015 Flanking Primer PCR pt. 3

Today I ran a PCR on the two new flanking primers Actin and HSP70 as well as re run some primers that failed to sequence (HSPb11, PGEEP4, BMP2). After running PCR, I ran the products out on gels and then extracted the bands for sequencing.

Primers:

1680	Flk_HSP70_FWD	GACCCGGATGTCCAGAGGAA	JH	6/9/2015	20	60	O.lurida	HSP70 Flanking
1679	Flk_HSP70_REV	TCAGGACGGCTTGTGAACG	JH	6/9/2015	19	60	O.lurida
1678	Flk_Actin_FWD	TCGAGGGAGGAAGAGGAAGC	JH	6/9/2015	20	59	O.lurida	Actin Flanking
1677	Flk_Actin_REV	AACTGGGACGACATGGAGAA	JH	6/9/2015	20	61	O.lurida
1666	Flk_HSPb11_FWD	AGAATTGTCTGTGGAATCGAGC	JH	6/1/2015	22	59	O.lurida	HSPb11 Flanking	Q9Y547
1665	Flk_HSPb11_REV	ATCAACGCCAGGGGAACTTG	JH	6/1/2015	20	61	O.lurida		Q9Y547
1664	Flk_PGE/EP4_FWD	GCTCAACGAATTGCTCTACTCC	JH	6/1/2015	22	59	O.lurida	PGE/EP4 Flanking	P32240
1663	Flk_PGE/EP4_REV	TCCGTCTGCTTTTTAGAATGGTA	JH	6/1/2015	23	58	O.lurida		P32240
1668	Flk_BMP2_FWD	GGCTGGCTGGATCGTCAT	JH	6/1/2015	18	60	O.lurida	BMP2 Flanking	P12643
1667	Flk_BMP2_REV	ATGGAGTCTGTGGACGGTTTG	JH	6/1/2015	21	60	O.lurida		P12643

Reagent Table:

Reaction_Components	Volume	Final Concentration
2x Apex Red	12.5	125
Forward Primer (10uM)	0.5	5
Reverse Primer (10uM)	0.5	5
H20	10.5	105
Template	1

Using the final concentration I mixed each master mix going from largest to smallest volume.

I then pipetted 24 ul in each well followed by 1 ul of water or sample depending.

Then I ran the following PCR program:

Temp	Time
95 C	5 min
95 C	30 sec
55 C	30 sec
72 C	30 sec
repeat steps 2-4 40 times
72 C	3 min
4 C	Hold

Once the PCR finished I ran 25 ul of each product on a 1.3% agarose gel

Gel Reagent Table

Reagent	Volume
1X Low TAE	175 ml
Agarose	2.3 g
EtBr	17.5 ul

Add agarose to TAE.
Microwave 1 minute stir
Repeat until no particulate matter in solution
Add EtBr while agarose still hot
Gently pour in one corner of the gel cast until tray is full

I then ran the gel at 100 v for 40 minutes. I placed it on the transilluminator to view any bands that may have formed. The gel is below

Gel Layout:

Actin

HSP70

Ladder

HC1

NC1

SC1

HT1

NT1

ST1

NTC

Ladder

HC1

NC1

SC1

HT1

NT1

ST1

NTC

Empty

PGEEP4

HSPb11

Ladder

HC1

NC1

SC1

HT1

NT1

ST1

NTC

Ladder

HC1

NC1

SC1

HT1

NT1

ST1

NTC

Empty

BMP2

Ladder

HC1

NC1

SC1

HT1

NT1

ST1

NTC

Empty

It appears the Actin flanking primer failed hard. The HSP70 primer seemed to do pretty well but still created several smaller bands. I carefully extracted only the largest band from the HSP70 samples to ensure that it was the right product. The rest of the primers worked like the had previously.

Once the bands were cut out of the gel and placed in a Millipore Purification Column and centrifuged at 5,000 rcf for 10 minutes to collect the purified DNA.

To send them off for sequencing I plated 4 replicates of 10 ul for each sample in the appropriate tube. On a second plate I plated two replicates of 3 uM primer working stock for each appropriate sample. These plates are now being held in the 4 C in 213 for sequencing.

Sam's last sequencing came back today and it appears there are more primers that need to be re amplified and sequenced I will work on that tomorrow. I will also make sure to send off the TLR2.1 samples as they were overlooked in the last batch.