Primers:
1505 | Ol_Act_F | GACCAGCCAAATCCAGACGA | BC | 6/13/2012 | 20 | 55 | 60 | O.lurida | Actin, adductor muscle |
1504 | Ol_Act_R | CGGTCGTACCACTGGTATCG | 6/13/2012 | 20 | 60 | 60 | O.lurida | Actin, adductor muscle |
Reagent Table:
Volume | Reactions X58 | |
Ssofast Evagreen MM | 10 | 580 |
FWD Primer | 0.5 | 29 |
REV Primer | 0.5 | 29 |
Nuclease Free H2O | 8 | 464 |
cDNA | 1 |
- Added reagents from greatest to least volume
- Vortexed
- Centrifuged briefly
- Pipetted 19 ul Master Mix to each tube
- Pipetted appropriate cDNA sample to each tube
- Centrifuged plate at 2000 rpm for 1 minute
- Ran Program Below
Program:
Step | Temperature | Time |
Initiation | 95 C | 10 min |
Elongation | 95 C | 30 sec |
60 C | 1 min | |
Read | ||
72 C | 30 sec | |
Read | ||
Repeat Elongation 39 times | ||
Termination | 95 C | 1 min |
55 C | 1 sec | |
Melt Curve Manual ramp 0.2C per sec Read 0.5 C | 55 - 95 C | 30 sec |
21 C | 10 min | |
End |
Plate Layout:
1 | 2 | 3 | 4 | 5 | 6 | 7 |
DNased 42215 HC1 | DNased 42215 NC1 | DNased 42215 SC1 | DNased 42215 HT1 1 | DNased 42215 NT1 1 | DNased 42215 ST1 1 | NTC |
DNased 42215 HC2 | DNased 42215 NC2 | DNased 42215 SC2 | DNased 42215 HT1 2 | DNased 42215 NT1 2 | DNased 42215 ST1 2 | NTC |
DNased 42215 HC3 | DNased 42215 NC3 | DNased 42215 SC3 | DNased 42215 HT1 3 | DNased 42215 NT1 3 | DNased 42215 ST1 3 | NTC |
DNased 42215 HC4 | DNased 42215 NC4 | DNased 42215 SC4 | DNased 42215 HT1 4 | DNased 42215 NT1 4 | DNased 42215 ST1 4 | NTC |
DNased 42215 HC5 | DNased 42215 NC5 | DNased 42215 SC5 | DNased 42215 HT1 5 | DNased 42215 NT1 5 | DNased 42215 ST1 5 | |
DNased 42215 HC6 | DNased 42215 NC6 | DNased 42215 SC6 | DNased 42215 HT1 6 | DNased 42215 NT1 6 | DNased 42215 ST1 6 | |
DNased 42215 HC7 | DNased 42215 NC7 | DNased 42215 SC7 | DNased 42215 HT1 7 | DNased 42215 NT1 7 | DNased 42215 ST1 7 | |
DNased 42215 HC8 | DNased 42215 NC8 | DNased 42215 SC8 | DNased 42215 HT1 8 | DNased 42215 NT1 8 | DNased 42215 ST1 8 |
Results:
NTCs
The actin primer showed relatively equal expression across samples which is what we expected since we're using a properly calibrated machine. There were no miss expression values for samples which means it was expressed in all populations. I ran this and the TLR2.1 Data through PCR Miner to analyze expression. I will talk about that in my next post.
The actin primer showed relatively equal expression across samples which is what we expected since we're using a properly calibrated machine. There were no miss expression values for samples which means it was expressed in all populations. I ran this and the TLR2.1 Data through PCR Miner to analyze expression. I will talk about that in my next post.
You can find the raw data file here.