Jake Heare Research Central

Tuesday, June 30, 2015

6 25 2015 CARM qPCR

I ran a qPCR on the CARM gene since it had good coverage and interesting results.

Primers:

1642	CARM1_FWD	TGGTTATCAACAGCCCCGAC	JH	5/21/2015	20	55		O.lurida	Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)	Q6DC04
1641	CARM1_REV	GTTGTTGACCCCAGGAGGAG	JH	5/21/2015	20	55		O.lurida	Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)	Q6DC04

Reagent Table:

	Volume	Reactions X58
Ssofast Evagreen MM	10	580
FWD Primer	0.5	29
REV Primer	0.5	29
Nuclease Free H2O	8	464
cDNA	1

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 19 ul Master Mix to each tube
Pipetted appropriate cDNA sample to each tube
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All Samples

NTCs

I ran replicates of this in the future and I will post about them soon.

You can see the raw data here.

6 26 2015 Actin 3 qPCR

Today I ran a replicate of the Actin qPCR on the Friedman qPCR machine. This is standard for producing reliable data for analysis.

Primers:

1505	Ol_Act_F	GACCAGCCAAATCCAGACGA	BC	6/13/2012	20	55	60	O.lurida	Actin, adductor muscle
1504	Ol_Act_R	CGGTCGTACCACTGGTATCG		6/13/2012	20	60	60	O.lurida	Actin, adductor muscle

Reagent Table:

	Volume	Reactions X58
Ssofast Evagreen MM	10	580
FWD Primer	0.5	29
REV Primer	0.5	29
Nuclease Free H2O	8	464
cDNA	1

Added reagents from greatest to least volume
Vortexed
Centrifuged briefly
Pipetted 19 ul Master Mix to each tube
Pipetted appropriate cDNA sample to each tube
Centrifuged plate at 2000 rpm for 1 minute
Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All Samples

NTCs

After this I ran a replicate of CARM which I will make the next post about.

You can see the raw data here.

Thursday, June 25, 2015

6 25 2015 Flanking PCR pt 4

Yesterday I ran a PCR for some flanking primers that failed to get good coverage based on Steven's analysis. Today I ran the products on a gel and excised the bands for sanger sequencing.

Primers:

1660	Flk_GRB2_FWD	TCAGAACTGGTTCAAAGCTGAGT	JH	6/1/2015	23	60	O.lurida	GRB2 Flanking	P62994
1659	Flk_GRB2_REV	ACTGCGCTGACATACTGGAC	JH	6/1/2015	20	60	O.lurida		P62994
1658	Flk_H3.3_FWD	CCAATGACAAATGAGCCACACAA	JH	6/1/2015	23	60	O.lurida	H3.3 Flanking	Q6P823
1657	Flk_H3.3_REV	TCGTACAAAGCAAACTGCACG	JH	6/1/2015	21	60	O.lurida		Q6P823
1656	Flk_H2A.V_FWD	GCGATGGAGTTGATGAGGTG	JH	6/1/2015	20	59	O.lurida	H2A.V Flanking	P08991
1655	Flk_H2A.V_REV	CAAGGCAGTTTCTCGTTCGG	JH	6/1/2015	20	59	O.lurida		P08991
1652	Flk_p29ING_FWD	GTGGACACACATGCACTCCT	JH	6/1/2015	20	60	O.lurida	p29ING4 Flanking	Q8C0D7
1651	Flk_p29ING_REV	AAGCAGACTCAGATTCAGGC	JH	6/1/2015	20	58	O.lurida		Q8C0D7

Reagent Table:

Reaction_Components	Volume	Final Concentration
2x Apex Red	12.5	125
Forward Primer (10uM)	0.5	5
Reverse Primer (10uM)	0.5	5
H20	10.5	105
Template	1

Using the final concentration I mixed each master mix going from largest to smallest volume.

I then pipetted 24 ul in each well followed by 1 ul of water or sample depending.

Then I ran the following PCR program:

Temp	Time
95 C	5 min
95 C	30 sec
55 C	30 sec
72 C	30 sec
repeat steps 2-4 40 times
72 C	3 min
4 C	Hold

Once the PCR finished I ran 25 ul of each product on a 1.3% agarose gel

Gel Reagent Table

Reagent	Volume
1X Low TAE	175 ml
Agarose	2.3 g
EtBr	17.5 ul

Add agarose to TAE.
Microwave 1 minute stir
Repeat until no particulate matter in solution
Add EtBr while agarose still hot
Gently pour in one corner of the gel cast until tray is full

I then ran the gel at 100 v for 40 minutes. I placed it on the transilluminator to view any bands that may have formed. In my haste I forgot to image the gel, Luckily the gel ran fine with strong banding and minor streaking due to over filled wells.

After running the gel I excised the bands. Once the bands were cut out of the gel and placed in a Millipore Purification Column and centrifuged at 5,000 rcf for 10 minutes to collect the purified DNA.

To send them off for sequencing I plated 4 replicates of 10 ul for each sample in the appropriate tube. On a second plate I plated two replicates of 3 uM primer working stock for each appropriate sample. These plates are now being held in the 4 C in 213 for sequencing.

Wednesday, June 24, 2015

6 24 2015 qPCR Quality Check

Today I ran a qPCR quality check to determine if our Opticon two is producing valid data. I did this because the other day we noticed a discrepancy with the data that showed samples in the top and bottom rows had lower expression than those in the middle rows. To test if the machine was working properly I made a master mix including a template of isolated gDNA that I know amplifies and equally distributed it across the plate.

Primer:

1505	Ol_Act_F	GACCAGCCAAATCCAGACGA	BC	6/13/2012	20	55	60	O.lurida	Actin, adductor muscle
1504	Ol_Act_R	CGGTCGTACCACTGGTATCG		6/13/2012	20	60	60	O.lurida	Actin, adductor muscle

Reagent Table:

	Volume	Reactions X52
Ssofast Evagreen MM	10	520
FWD Primer	0.5	26
REV Primer	0.5	26
Nuclease Free H2O	8	416
gDNA	1	52

The sample I used was from Oly seed oyster isolations I did a while back.

Sample Info:

Sample ID	Date	Time	ng/ul
NF20	5/7/2015	11:17 AM	876.31

To make the master mix I added all the reagents together from greatest volume to least volume and then added the gDNA template. I vortexed briefly to ensure homogeneous mixture. I then pipetted 20 ul of this mixture into every other well to make a checker board pattern on the plate.

Plate Layout:

1	2	3	4	5	6	7	8	9	10	11	12
Sample		Sample		Sample		Sample		Sample		Sample
	Sample		Sample		Sample		Sample		Sample		Sample
Sample		Sample		Sample		Sample		Sample		Sample
	Sample		Sample		Sample		Sample		Sample		Sample
Sample		Sample		Sample		Sample		Sample		Sample
	Sample		Sample		Sample		Sample		Sample		Sample
Sample		Sample		Sample		Sample		Sample		Sample
	Sample		Sample		Sample		Sample		Sample		Sample

This pattern was to test the machines fluorescence reading capabilities across the entire plate without having to fill every well with sample.

I ran the following program which is the same for all the other qPCR's that I have been running.

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Results:

Amplification

Melt Curve

Plate Fluorescence

As you can see from the amplification, while all of the well should have had exactly the same amplification there was a significant difference between wells with some wells being orders of magnitude higher. The melt curve shows similar. My favorite image though is the plate fluorescence which shows a rough estimate of the fluorescence detected in each well by the machine. Clearly the center wells have higher fluorescence detection than wells along the edges of the plate. At this time it is apparent that we need to recalibrate the Opticon as it clearly is not producing valid data.