Primers:
1702 | 28s_3_FWD | TAAGGCCAGTGTGGGAGAGA | JH | 8/12/2015 | 20 | 55 | 59.88 | O.lurida | "28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)" | Q5REJ1 |
1701 | 28s_3_REV | CGCCTCACTTTTTGTGCCTC | JH | 8/12/2015 | 20 | 55 | 60.04 | O.lurida | "28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)" | Q5REJ1 |
1700 | 18s_2_FWD | CTCGATTCCCTTTCCCCCAC | JH | 8/12/2015 | 20 | 60 | 60.11 | O.conchaphila | 18s Ribosomal RNA | EF035117.1 |
1699 | 18s_2_REV | GCCCGATCTCTTTCCACCTC | JH | 8/12/2015 | 20 | 60 | 60.18 | O.conchaphila | 18s Ribosomal RNA | EF035117.1 |
1698 | 18s_1_FWD | TTCCTTTTCCCCCACTCAGC | JH | 8/12/2015 | 20 | 55 | 59.89 | O.conchaphila | 18s Ribosomal RNA | EF035118.1 |
1697 | 18s_1_REV | CGCTTCACTCGCCGTTACTA | JH | 8/12/2015 | 20 | 55 | 60.18 | O.conchaphila | 18s Ribosomal RNA | EF035118.1 |
Reagent Table:
Volume | Reactions X10 | |
Ssofast Evagreen MM | 10 | 100 |
FWD Primer | 0.5 | 5 |
REV Primer | 0.5 | 5 |
PCR H2O | 5 | 50 |
1:9 cDNA | 4 |
- Added reagents from greatest to least volume
- Vortexed
- Centrifuged briefly
- Pipetted 16 ul Master Mix to each tube
- Pipetted 4 ul of 1:9 cDNA each column using a channel pipetter
- Centrifuged plate at 2000 rpm for 1 minute
- Ran Program Below
Program:
Step | Temperature | Time |
Initiation | 95 C | 10 min |
Elongation | 95 C | 30 sec |
60 C | 1 min | |
Read | ||
72 C | 30 sec | |
Read | ||
Repeat Elongation 39 times | ||
Termination | 95 C | 1 min |
55 C | 1 sec | |
Melt Curve Manual ramp 0.2C per sec Read 0.5 C | 55 - 95 C | 30 sec |
21 C | 10 min | |
End |
Table Layout:
18s_1 | 18s_2 | 28s_3 | ||
1 | 2 | 3 | 4 | 5 |
DNased 42215 HM1 1 | DNased 42215 NM1 1 | DNased 42215 SM1 1 | 18s_1_NTC | 18s_1_NTC |
DNased 42215 HM1 2 | DNased 42215 NM1 2 | DNased 42215 SM1 2 | 18s_2_NTC | 18s_2_NTC |
DNased 42215 HM1 3 | DNased 42215 NM1 3 | DNased 42215 SM1 3 | 28s_3_NTC | 28s_3_NTC |
DNased 42215 HM1 4 | DNased 42215 NM1 4 | DNased 42215 SM1 4 | ||
DNased 42215 HM1 5 | DNased 42215 NM1 5 | DNased 42215 SM1 5 | ||
DNased 42215 HM1 6 | DNased 42215 NM1 6 | DNased 42215 SM1 6 | ||
DNased 42215 HM1 7 | DNased 42215 NM1 7 | DNased 42215 SM1 7 | ||
DNased 42215 HM1 8 | DNased 42215 NM1 8 | DNased 42215 SM1 8 |
18s_1
All
NTC
18s_2
All
NTC
28s_3
All
NTC
The 18s primers each have issues. The first has seemingly random amplification and poor melt curves. The second seems to autoamplify and has NTCs with amplification equal to the samples.
The 28s primer looks great. It has strong amplification with only primer dimers appearing in the NTCs. I think this should be used for the next normalizing primers.