6 23 2015 TLR2.1 qPCR

Yesterday after discovering that the Opticon was acting up, I decided to run a couple qPCR's on the Biorad CFX in the Friedman lab. The first was the TLR2.1 gene which had not been present in the Dabob population during the initial primer checks.

Primer:

1630	TLR2.1_FWD	ACAAAGATTCCACCCGGCAA	JH	5/21/2015	20	55		O.lurida	Toll-like receptor 2 type-1	Q9DD78
1629	TLR2.1_REV	ACACCAACGACAGGAAGTGG	JH	5/21/2015	20	55		O.lurida	Toll-like receptor 2 type-1	Q9DD78

Reagent Table:

	Volume	Reactions X58
Ssofast Evagreen MM	10	580
FWD Primer	0.5	29
REV Primer	0.5	29
Nuclease Free H2O	8	464
cDNA	1

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 19 ul Master Mix to each tube
5. Pipetted appropriate cDNA sample to each tube
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All Samples

NTCs

So the graph doesn't really do justice for the results. There is amplification in a majority of samples but interestingly only about half of the Dabob population shows expression of this allele. The other half show absolutely no expression. There are a few individuals which show a very low expression of this allele but others show some of the highest expression. Overall this is pretty confusing and may be indicative that the Dabob population is more heterogeneous for this allele than the other populations. After running this qPCR, I ran another Actin qPCR using the friedman machine to create a normalizing standard which I will talk about in my next post.

You can view the raw data here.

6 9 2015 Flanking Primer Trial PCR

Today I ran a trial PCR on subsample of the flanking primers to see if they worked correctly. The primers I used were:

1676	Flk_TLR_FWD	GCAATAGCTTGTCACCGCC	JH	6/1/2015	20		59	O.lurida	TLR2.1 Flanking	Q9DD78
1675	Flk_TLR_REV	TCTAGTATGCGCTTCGTTTGC	JH	6/1/2015	20		59	O.lurida		Q9DD78
1674	Flk_CRAF_FWD	GGACATCCAGTGGCAACATTC	JH	6/1/2015	21		60	O.lurida	CRAF1 Flanking	Q60803
1673	Flk_CRAF_REV	CCAGGACATTAGGCTTGCTGA	JH	6/1/2015	21		60	O.lurida		Q60803

Using the Apex Red PCR Master Mix I created master mixes for each set of primers and ran them together. 

Reagent Table

Reaction_Components	Volume	Final Concentration
2x Apex Red	12.5	125
Forward Primer (10uM)	0.5	5
Reverse Primer (10uM)	0.5	5
H20	10.5	105
1:1 cDNA	1
	25

Using the final concentration I mixed each master mix going from largest to smallest volume. 

I then pipetted 24 ul in each well followed by 1 ul of water or sample depending. 

Then I ran the following PCR program:

Temp	Time
95 C	5 min
95 C	30 sec
55 C	30 sec
72 C	30 sec
repeat steps 2-4 40 times
72 C	3 min
4 C	Hold

Once the PCR finished I ran the products on a 1.3% agarose gel

Gel Reagent Table

Reagent	Volume
1X Low TAE	100 ml
Agarose	1.3 g
EtBr	10 ul

1. Add agarose to TAE.
2. Microwave 1 minute stir
3. Repeat until no particulate matter in solution
4. Add EtBr while agarose still hot
5. Gently pour in one corner of the gel cast until tray is full 

I then ran the gel at 100 v for 35 minutes. I placed it on the transilluminator to view any bands that may have formed. The gel is below. 

Gel Layout:

TLR2.1

CRAF 1

Empty

Ladder

NTC

NT1

HT1

ST1

NC1

HC1

SC1

NTC

Ladder

NTC

NT1

HT1

ST1

NC1

HC1

SC1

NTC

Ladder

Empty

As you can tell the TLR2.1 primers still did not amplify in the Dabob population. This could be an indication that this gene is not expressed in this population. More population replicates are needed to determine if this is true. 

After seeing these nice bands, I cut them out and stored the individual bands for sequencing in 1.5 ml tubes. I also decided to run the remaining primers using the reagents above and then produce the gels tomorrow. 

4 23 2015 Heat/Mechanical Shock 24 Hour Time Point

Today I completed the 24 hour time point collection and the collection of the controls for the experiment. Tonight I ran out of liquid nitrogen before doing the control groups. I put them on ice and placed them in the -80 ASAP.

Heat Stress

• 24 hours post exposure 8 animals each pop staggered by 1 hour
  • N pop first, H pop next, S pop last
  • collected with ethanol flame sterilized forceps and scissors
    • tools kept in 100% EtOH
    • ran through EtOH flame
    • allow EtOH to burn off
    • Collect tissue
    • replace in 100% EtOH
    • wipe occasionally with paper towel and resterilize
  • ctenidia sample (50-100 mg) homogenized in 1 ml RNAzol stored at -80°C
  • 2nd ctenidia sample in 1.5 ml screw cap tube dropped into liquid nitrogen then to -80°C
  • mantle sample in 1.5 ml screw cap tube dropped into liquid nitrogen -80°C
  • remaining tissue placed in 15 ml conical with 75% EtOH at -20°C
  • shells placed in labeled plastic bags so correspond to sample including oyster id

Mechanical Stress

• 24 hours post exposure 8 animals each pop staggered by 1 hour
  • N pop first, H pop next, S pop last
  • collected with ethanol flame sterilized forceps and scissors
    • tools kept in 100% EtOH
    • ran through EtOH flame
    • allow EtOH to burn off
    • Collect tissue
    • replace in 100% EtOH
    • wipe occasionally with paper towel and resterilize
  • ctenidia sample (50-100 mg) homogenized in 1 ml RNAzol stored at -80°C
  • 2nd ctenidia sample in 1.5 ml screw cap tube dropped into liquid nitrogen then to -80°C
  • mantle sample in 1.5 ml tube dropped into liquid nitrogen - then to -80°C
  • remaining tissue placed in 15 ml conical with 75% EtOH at -20°C
  • shells placed in labeled plastic bags so correspond to sample including oyster id

Controls

For controls sample 8 from each group, this should be done on day 2 as less things are going on. Protocol is the same. These oyster should have remained in holding tank-throughout and should simply be removed and sampled. There is no treatment. Using sterile techniqes.

• ctenidia sample (50-100 mg) homogenized in 1 ml RNAzol stored at -80°C
• 2nd ctenidia sample (any remaining) in 1.5 ml screw cap tube dropped into liquid nitrogen then to -80°C
• mantle sample (50-100 mg) in 1.5 ml tube dropped into liquid nitrogen then to -80°C
• remaining tissue placed in 15 ml conical with 75% EtOH at -20°C
• shells placed in labeled plastic bags so correspond to sample including oyster id

4 22 2015 Heat/Mechanical Shock Experiment

Today I ran the Heat and Mechanical Shock experiment on my oysters. While most groups got liquid nitrogen treatment, the mechanical H and S groups did not due to lack of Liquid N2. For those samples I placed them on ice and moved them to the -80 as soon as possible.  The procedure went as follows.

Pre-Experiment

Oysters

• 8°C
• fed daily with 5-10 ml per tank commercial shellfish diet (Isochrysis 1800 mix Marine Algae)
• Partial water changes once per week (remove 5 gallons, replace with fresh 5 gallons)
  • Seawater from Seattle Aquarium
• Aeration with aquarium aerator/stone
• circulation with underwater pump
• Tanks 10 gallon plastic storage tubs (costco storage tubs)

Homogenization tubes for ctenidia prelabelled with date (42215,42315), pop (N,H,S), treatment (T,M) and time point (1, 24) or Control, and oyster # (1,2,3...)

Collection 1.5 ml tubes (screw cap) for ctenidia prelabelled with date (42215,42315), pop (N,H,S), treatment (T,M) and time point (1, 24) or Control, oyster # (1,2,3...), and tissue type (C, M)

Collection 1.5 ml tubes (screw cap) for mantle prelabelled with date (42215,42315), pop (N,H,S), treatment (T,M) and time point (1, 24) or Control, oyster # (1,2,3...), and tissue type (C, M)

15 ml conical tubes for whole oyster prelabelled with date (42215,42315), pop (N,H,S), treatment (T,M) and time point (1, 24) or Control, and oyster # (1,2,3...)

Warm fresh seawater in 500 ml beaker to 38°C by immersing it in a water bath at 38°C.

Experiment

Heat Stress

• 22 oysters each pop in a mesh bag were lowered (stagger each pop by 1 hour) into 500 ml of prewarmed 38°C sea water (1 hr timer started)
  
  • N pop first, H pop next, S pop last
• after 1 hour exposure heat stress ends, animals returned to 8°C water.
• 1 hour post exposure 8 animals sampled from each group staggered by 1 hour
  • N pop first, H pop next, S pop last
  • collected with ethanol flame sterilized forceps and scissors
    • tools kept in 100% EtOH
    • ran through EtOH flame
    • allow EtOH to burn off
    • Collect tissue
    • replace in 100% EtOH
    • wipe occasionally with paper towel and resterilize
  • ctenidia sample (50-100 mg) homogenized in 1 ml Trizol stored at -80°C
  • 2nd ctenidia sample (any remaining) in 1.5 ml screw cap tube dropped into liquid nitrogen then to -80°C
  • mantle sample (decent size) in 1.5 ml screw cap tube dropped into liquid nitrogen then to -80°C
  • remaining tissue placed in 15 ml conical with 75% EtOH at -20°C
  • shells in individual labeled ziploc bags so correspond to sample including oyster id

Mechanical Stress

• 22 oysters from 1 pop placed in bucket in centrifuge and spun for 5 minutes at 1000 rpm.  Samples staggered by 1 hour. Completed after all heat shock treatments and samples were taken.
  • N pop first, H pop next, S pop last
• after 5 minutes of mechanical stress, animals returned to 8°C water
• 1 hour post exposure 8 animals sampled from each group staggered by 1 hour
  • N pop first, H pop next, S pop last
  • collected with ethanol flame sterilized forceps and scissors
    • tools kept in 100% EtOH
    • ran through EtOH flame
    • allow EtOH to burn off
    • Collect tissue
    • replace in 100% EtOH
    • wipe occasionally with paper towel and resterilize
  • ctenidia sample (50-100 mg) homogenized in 1 ml Trizol stored at -80°C
  • 2nd ctenidia sample (any remaining) in 1.5 ml screw cap tube dropped into liquid nitrogen then to -80°C
  • mantle sample (decent size) in 1.5 ml screw cap tube dropped into liquid nitrogen then to -80°C
  • remaining tissue placed in 15 ml conical with 75% EtOH at -20°C
  • shells in individual labeled ziploc bags so correspond to sample including oyster id

4 1 2015 EZNA Dabob pt 2 and Oyster pt 3

Today I continued the seed DNA isolation. I completed the 32 Dabob Seeds and the 32 Oyster Bay Seeds as appropriate. You can read about the previous Dabob isolation here. You can read about the other Oyster bay Isolations here and here.

Before using the EZNA Kit I dissected out whole body tissue from 14 seed oysters into the homogenization tube. The oysters are labeled SN 31-32 and HL 21-32. I used flame sterilized equipment to dissect the animals. 

The protocol is as follows:

1. Added 350 ul ML1 Buffer
2. Added 25 ul Proteinase K solution
3. Used pestle in homogenization tube to grind tissue in solution
4. Vortexed
5. Incubated at 60 C for 30 minutes
6. Added 350 ul Phenol:Chloroform:Isoamyl Alcohol (25:24:1)
7. Vortexed
8. Centrifuged 10,000 g for 2 minutes
9. Transferred the upper aqueous phase to new tube (~300 ul)
10. Added 300 ul MBL Buffer
11. Added 10 ul RNase A
12. Vortexed for 15 seconds
13. Incubated at 70C (started at 67.5 C) for 10 minutes
14. Cooled to room temperature sitting for 5 minutes
15. Added 300 ul 100% EtOH
16. Vortexed for 15 seconds
17. Put spin column in collection tube
18. Added 750 ul sample solution to column
19. Centrifuged at 10,000 g for 1 minute at 4C
20. Discarded flowthrough
21. Repeated 18-20 with remaining sample
22. Discarded collection tube and replaced with a new one. 
23. Added 500 ul HBC solution. 
24. Centrifuged at 10,000 g for 30 seconds at 4C
25. Discarded flowthrough
26. Added 700 ul DNA Wash Buffer
27. Centrifuged at 10,000 g for 1 minute at 4C
28. Discarded flowthrough
29. Repeated 26-28
30. Centrifuged Empty column for 2 minutes at 10,000 g at 4C
31. Discarded collection tube and put column into microcentrifuge tube for sample collection
32. Added 100 ul preheated 70C Elution Buffer
33. Incubated for 2 minutes
34. Centrifuged at 10,000 g for 1 minute at 4C
35. Repeated 32-34. 
36. Stored DNA at -20 C

DNA is in a box labelled:

Seed Oly DNA HL 

3/23/15 Jake Heare

Seed Oly DNA SN 

3/31/15 JH 2 of 2

3 24 2015 EZNA Seed Isolation Gel Run

I ran a subset of the samples from yesterday. The samples were HL 1-6. The DNA looks very degraded still. There were only two of the 6 that I would consider usuable, 2 were questionable, and 2 were fully degraded. Moving forward, it looks like the EZNA kit can salvage usuable samples from some of the seed but not all of them. This is pretty similar to the Qiagen 96 Well Plate kit in this instance. Since we've already ordered the 200 reaction kit for the EZNA and I've processed 20 dabob seed and am processing another 20 Fidalgo seed today it seems only reasonable to continue using this kit.

Gel Protocol:

75 ml Low TAE with 0.6 g Agarose and 7.5 ul EtBr.

Run at 120 V for 55 minutes.

10 ul Ladder, 20 ul sample mixed with 3 ul loading dye.

Gel Layout:

Well	1	2	3	4	5	6	7	8
Sample	Ladder	HL 1	HL 2	HL 3	HL 4	HL 5	HL 6	Ladder

Gel with Dabob Seed DNA Isolation

Close up of High Molecular Weight Material. 

3 23 2015 EZNA DNA Isolation with Seed Oysters

Due to the success of the EZNA kit last week with frozen tissue from September 2014, We have decided to begin extracting DNA from seed oysters to develop high quality libraries for sequencing. Today I processed 20 Dabob Bay seed oysters from August 2013 with the EZNA kit. The process is basically identical to last weeks except I used the refridgerated centrifuge for a few steps because it could spin more samples than my desktop centrifuge.  

Before using the EZNA Kit I dissected out whole body tissue from 20 seed oysters into the homogenization tube. The oysters are labeled HL1-20. I used flame sterilized equipment to dissect the animals. 

The protocol is as follows:

1. Added 350 ul ML1 Buffer
2. Added 25 ul Proteinase K solution
3. Used pestle in homogenization tube to grind tissue in solution
4. Vortexed
5. Incubated at 60 C for 30 minutes
6. Added 350 ul Phenol:Chloroform:Isoamyl Alcohol (25:24:1)
7. Vortexed
8. Centrifuged 10,000 g for 2 minutes
9. Transferred the upper aqueous phase to new tube (~300 ul)
10. Added 300 ul MBL Buffer
11. Added 10 ul RNase A
12. Vortexed for 15 seconds
13. Incubated at 70C (started at 67.5 C) for 10 minutes
14. Cooled to room temperature sitting for 5 minutes
15. Added 300 ul 100% EtOH
16. Vortexed for 15 seconds
17. Put spin column in collection tube
18. Added 750 ul sample solution to column
19. Centrifuged at 10,000 g for 1 minute at 4C
20. Discarded flowthrough
21. Repeated 18-20 with remaining sample
22. Discarded collection tube and replaced with a new one. 
23. Added 500 ul HBC solution. 
24. Centrifuged at 10,000 g for 30 seconds at 4C
25. Discarded flowthrough
26. Added 700 ul DNA Wash Buffer
27. Centrifuged at 10,000 g for 1 minute at 4C
28. Discarded flowthrough
29. Repeated 26-28
30. Centrifuged Empty column for 2 minutes at 10,000 g at 4C
31. Discarded collection tube and put column into microcentrifuge tube for sample collection
32. Added 100 ul preheated 70C Elution Buffer
33. Incubated for 2 minutes
34. Centrifuged at 10,000 g for 1 minute at 4C
35. Repeated 32-34. 
36. Stored DNA at -20 C

Tomorrow I will run the DNA out on a gel to check for quality. 

9 14 2014 Kaplan Meier Graphs Improved

KMgraphsWorking.R

Jake H

Sun Sep 14 14:41:29 2014

library(survival)

## Loading required package: splines

kmdab=read.csv("KMdataDabob.csv")
names(kmdab)    

## [1] "Animal"     "Population" "Death"      "Status"

with(kmdab, tapply(Death[Status==1],Population[Status==1],mean))

##     H     N     S 
## 4.385 4.522 4.715

with(kmdab, tapply(Death[Status==1],Population[Status==1],var))

##      H      N      S 
## 0.4524 0.9786 1.6039

fit1=with(kmdab,survfit(Surv(Death,Status)~Population))
plot(fit1, col=c(1:3), xlab="Survival Time from Outplant in Months", ylab="% Surviving")
legend("bottomleft", title="Population", c("Dabob","Fidalgo","Oyster Bay"), fill=c(1:3))

kmman=read.csv("KMdataMan.csv")
names(kmman)

## [1] "Animal"     "Population" "Death"      "Status"

with(kmman, tapply(Death[Status==1],Population[Status==1],mean))

##      H      N      S 
## 10.540  9.368  9.197

with(kmman, tapply(Death[Status==1],Population[Status==1],var))

##     H     N     S 
## 1.519 6.468 6.321

fit2=with(kmman, survfit(Surv(Death,Status)~Population))
plot(fit2, col=c(1:3), xlab="Survival Time from Outplant in Months", ylab="% Surviving")
legend("bottomleft", title="Population", c("Dabob","Fidalgo","Oyster Bay"), fill=c(1:3))

kmfid=read.csv("KMdataFid.csv")
with(kmfid, tapply(Death[Status==1],Population[Status==1],mean))

##     H     N     S 
## 5.921 5.754 6.897

with(kmfid, tapply(Death[Status==1],Population[Status==1],var))

##     H     N     S 
## 2.554 2.189 3.989

fit3=with(kmfid, survfit(Surv(Death,Status)~Population))
plot(fit3, col=c(1:3), xlab="Survival Time from Outplant in Months", ylab="% Surviving")
legend("bottomleft", title="Population", c("Dabob","Fidalgo","Oyster Bay"), fill=c(1:3))

kmoys=read.csv("KMdataOys.csv")
with(kmoys, tapply(Death[Status==1],Population[Status==1],mean))

##     H     N     S 
## 7.550 8.069 8.396

with(kmoys, tapply(Death[Status==1],Population[Status==1],var))

##     H     N     S 
## 7.774 5.805 5.814

fit4=with(kmoys, survfit(Surv(Death,Status)~Population))
plot(fit4, col=c(1:3), xlab="Survival Time from Outplant in Months", ylab="% Surviving")
legend("bottomleft", title="Population", c("Dabob","Fidalgo","Oyster Bay"), fill=c(1:3))