| 1676 | Flk_TLR_FWD | GCAATAGCTTGTCACCGCC | JH | 6/1/2015 | 20 | 59 | O.lurida | TLR2.1 Flanking | Q9DD78 | |
| 1675 | Flk_TLR_REV | TCTAGTATGCGCTTCGTTTGC | JH | 6/1/2015 | 20 | 59 | O.lurida | Q9DD78 | ||
| 1674 | Flk_CRAF_FWD | GGACATCCAGTGGCAACATTC | JH | 6/1/2015 | 21 | 60 | O.lurida | CRAF1 Flanking | Q60803 | |
| 1673 | Flk_CRAF_REV | CCAGGACATTAGGCTTGCTGA | JH | 6/1/2015 | 21 | 60 | O.lurida | Q60803 |
Using the Apex Red PCR Master Mix I created master mixes for each set of primers and ran them together.
Reagent Table
| Reaction_Components | Volume | Final Concentration |
| 2x Apex Red | 12.5 | 125 |
| Forward Primer (10uM) | 0.5 | 5 |
| Reverse Primer (10uM) | 0.5 | 5 |
| H20 | 10.5 | 105 |
| 1:1 cDNA | 1 | |
| 25 |
Using the final concentration I mixed each master mix going from largest to smallest volume.
I then pipetted 24 ul in each well followed by 1 ul of water or sample depending.
Then I ran the following PCR program:
| Temp | Time |
| 95 C | 5 min |
| 95 C | 30 sec |
| 55 C | 30 sec |
| 72 C | 30 sec |
| repeat steps 2-4 40 times | |
| 72 C | 3 min |
| 4 C | Hold |
Once the PCR finished I ran the products on a 1.3% agarose gel
Gel Reagent Table
| Reagent | Volume |
| 1X Low TAE | 100 ml |
| Agarose | 1.3 g |
| EtBr | 10 ul |
- Add agarose to TAE.
- Microwave 1 minute stir
- Repeat until no particulate matter in solution
- Add EtBr while agarose still hot
- Gently pour in one corner of the gel cast until tray is full
I then ran the gel at 100 v for 35 minutes. I placed it on the transilluminator to view any bands that may have formed. The gel is below.
Gel Layout:
| TLR2.1 | CRAF 1 | Empty | |||||||||||||||||
| Ladder | NTC | NT1 | HT1 | ST1 | NC1 | HC1 | SC1 | NTC | Ladder | NTC | NT1 | HT1 | ST1 | NC1 | HC1 | SC1 | NTC | Ladder | Empty |
As you can tell the TLR2.1 primers still did not amplify in the Dabob population. This could be an indication that this gene is not expressed in this population. More population replicates are needed to determine if this is true.
After seeing these nice bands, I cut them out and stored the individual bands for sequencing in 1.5 ml tubes. I also decided to run the remaining primers using the reagents above and then produce the gels tomorrow.
