Showing posts with label Stress Experiment. Show all posts
Showing posts with label Stress Experiment. Show all posts

Thursday, May 28, 2015

5 27 2015 New Primer Check (1-12)

Yesterday I received the new primers that I designed using the oly transcriptome. You can read about that here. Sam rehydrated the original stocks and I produced work stocks from them to use in a plate.

To make the working stock of the primers.

  1. 90 ul of Nuclease free (or Nanopure) H20 to 1.5 ml tube
  2. 10 ul of Stock primers
  3. Vortex briefly
I made these carefully in order to produce the following 12 pairs of primers. 


Hspb11_FWDATGTTTCCTGGTCTCCGTCAJH5/21/20152055O.luridaHeat shock protein beta-11 (Hspb11) (Placental protein 25) (PP25)
Hspb11_REVCATCAACGCCAGGGGAACTTJH5/21/20152055O.luridaHeat shock protein beta-11 (Hspb11) (Placental protein 25) (PP25)
GDF-8_FWDCCGTGGATGTCGCAGAAAGAJH5/21/20152055O.luridaGrowth/differentiation factor 8 (GDF-8) (Myostatin) (Myostatin-1) (zfMSTN-1) (Myostatin-B)
GDF-8_REVCTGCTTTCTCCGTCCCCTTTJH5/21/20152055O.luridaGrowth/differentiation factor 8 (GDF-8) (Myostatin) (Myostatin-1) (zfMSTN-1) (Myostatin-B)
HSP70b_FWDAAGTACCTTGGGGAGCTTGCJH5/21/20152055O.luridaHeat shock 70 kDa protein 12B
HSP70b_REVTCCACAGACTTTCCTCCCCAJH5/21/20152055O.luridaHeat shock 70 kDa protein 12B
GRP-78_FWDGAGAAACCACGCAGGGAGAAJH5/21/20152055O.lurida78 kDa glucose-regulated protein (GRP-78) (Heat shock 70 kDa protein 5) (Immunoglobulin heavy chain-binding protein) (BiP)
GRP-78_REVCATCAGCATCGAAGGCAACGJH5/21/20152055O.lurida78 kDa glucose-regulated protein (GRP-78) (Heat shock 70 kDa protein 5) (Immunoglobulin heavy chain-binding protein) (BiP)
CARM1_FWDTGGTTATCAACAGCCCCGACJH5/21/20152055O.luridaHistone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)
CARM1_REVGTTGTTGACCCCAGGAGGAGJH5/21/20152055O.luridaHistone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)
BMP-2_FWDTGAAGGAACGACCAAAGCCAJH5/21/20152055O.luridaBone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)
BMP-2_REVTCCGGTTGAAGAACCTCGTGJH5/21/20152055O.luridaBone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)
PGE/EP4_FWDACAGCGACGGACGATTTTCTJH5/21/20152055O.luridaProstaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)
PGE/EP4_REVATGGCAGACGTTACCCAACAJH5/21/20152055O.luridaProstaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)
CRAF1_FWDAGCAGGGCATCAAACTCTCCJH5/21/20152055O.luridaTNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN)
CRAF1_REVACAAGTCGCACTGGCTACAAJH5/21/20152055O.luridaTNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN)
NFKBina_FWDGATGGCGGTGCATGTGTTAGJH5/21/20152055O.luridaNF-kappa-B inhibitor alpha (I-kappa-B-alpha) (IkB-alpha) (IkappaBalpha) (REL-associated protein pp40)
NFKBina_REVCGAGGAGAACCTTGTGCAGTJH5/21/20152055O.luridaNF-kappa-B inhibitor alpha (I-kappa-B-alpha) (IkB-alpha) (IkappaBalpha) (REL-associated protein pp40)
PGRP-S_FWDGAGACTTCACCTCGCACCAAJH5/21/20152055O.luridaPeptidoglycan recognition protein 1 (Peptidoglycan recognition protein short) (PGRP-S)
PGRP-S_REVAACTGGTTTGCCCGACATCAJH5/21/20152055O.luridaPeptidoglycan recognition protein 1 (Peptidoglycan recognition protein short) (PGRP-S)
TLR2.1_FWDACAAAGATTCCACCCGGCAAJH5/21/20152055O.luridaToll-like receptor 2 type-1
TLR2.1_REVACACCAACGACAGGAAGTGGJH5/21/20152055O.luridaToll-like receptor 2 type-1
GDF-8b_FWDAACTGATTCTGCTCGTCGCAJH5/21/20152055O.luridaGrowth/differentiation factor 8 (GDF-8) (Myostatin)
GDF-8b_REVTGTTCTTCCACCCACCACTGJH5/21/20152055O.luridaGrowth/differentiation factor 8 (GDF-8) (Myostatin)

After producing the working stocks I then made a 10 reaction master mix. 

Master Mix reagent table
VolumeReactions X10
Ssofast Evagreen MM 10100
FWD Primer0.55
REV Primer0.55
Nanopure H2O880
cDNA1
Protocol:
  1. Added Ssofast to each of 12 tubes
  2. Added Nanopure water to each of 12 tubes
  3. Carefully added FWD primer, then Reverse primer to the appropriate tube
  4. Vortex briefly
  5. One Master Mix used per column in plate
  6. Pipette 19 ul of master mix to each well for the appropriate column
  7. Either No Template Control (NTC) or sample for each Row in the plate
  8. 1 ul Sample/NTC per well in the appropriate row
Table Layout:
Hspb11GDF-8HSP70bGRF-78CARM1BMP2PGE/EP4CRAF1NFKBinaPGRP-STLR2.1GDF-8b
123456789101112
NTCNTCNTCNTCNTCNTCNTCNTCNTCNTCNTCNTC
NT1NT1NT1NT1NT1NT1NT1NT1NT1NT1NT1NT1
HT1HT1HT1HT1HT1HT1HT1HT1HT1HT1HT1HT1
ST1ST1ST1ST1ST1ST1ST1ST1ST1ST1ST1ST1
NC1NC1NC1NC1NC1NC1NC1NC1NC1NC1NC1NC1
HC1HC1HC1HC1HC1HC1HC1HC1HC1HC1HC1HC1
SC1SC1SC1SC1SC1SC1SC1SC1SC1SC1SC1SC1
NTCNTCNTCNTCNTCNTCNTCNTCNTCNTCNTCNTC
qPCR Program:
Sybr New Plate+Sybr cDNA 60 melt 2 Read
StepTemperatureTime
Initiation95 C10 min
Elongation95 C30 sec
55 C1 min
Read
72 C30 sec
Read
Repeat Elongation 39 times
Termination95 C1 min
55 C1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C55 - 95 C30 sec
21 C10 min
End

Results:
HSPb11 Amplification

HSPb11 Melt Curve

GDF-8 Amplification
 GDF-8 Melt Curve
HSP70b Amplification

 HSP70b Melt Curve
GRF-78 Amplification


GRF-78 Melt Curve
CARM1 Amplification

 CARM1 Melt Curve
BMP2 Amplification


BMP2 Melt Curve

PGE/EP4 Amplification

PGE/EP4 Melt Curve
CRAF1 Amplification


CRAF1 Melt Curve
NFKBina Amplification

 NFKBina Melt Curve

PGRP-S Amplification
 PGRP-S Melt Curve
TLR2.1 Amplification

 TLR2.1 Melt Curve

GDF-8b Amplification
 GDF-8b Melt Curve


There was some very interesting results. 

CARM1, BMP2, HSP11b, and PGE/EP4 All showed down regulation from heat shock in all populations.

GDF-8 Had High expression in Fidalgo

CRAF1 had Up regulation in the Oyster Bay population and down regulation in others

PGRP-S had Up regulation in the Dabob population and down regulation in the others

TLR2.1 Had the most interesting response. It was down regulated in the Fidalgo bay population, Equal Expression in the Oyster Bay population, and did not amplify in either Dabob sample. 

HSP70b, GRF-78, NFKBina and GDF-8b had severe issues with the melt curve and odd expression in the samples. These four primers are probably not useful. 

I'm testing the next batch of primers now and will report the results when the come in. 

You can see the raw qPCR file here.

Wednesday, May 27, 2015

5 27 2015 Actin HSP70 re run

After reviewing yesterdays qPCR run with Steven, it was decided that I should re run the Actin and HSP70 qPCR again but with a higher annealing temperature. I've been using 55 C for previous runs but was having some issues with products and melt curves.

Master Mix Reagent Table.

VolumeReactions X18
Ssofast Evagreen MM 10180
FWD Primer0.59
REV Primer0.59
Nuclease Free H2O8144
cDNA1

1. Added each from greatest volume to least to make the master mix for each primer. 
2. Pipetted 19 ul master mix into each well of a qPCR partial plate
3. Added 1 ul sample to each tube

Plate Layout:
ActinActinHSP70HSP70
1234
NTCNTCNTCNTC
NT1 NT1 NT1NT1
HT1HT1HT1HT1
ST1ST1ST1ST1
NC1NC1NC1NC1
HC1HC1HC1HC1
SC1SC1SC1SC1
NTCNTCNTCNTC
qPCR Program:
Sybr New Plate+Sybr cDNA 60 melt 2 Read
StepTemperatureTime
Initiation95 C10 min
Elongation95 C30 sec
55 C1 min
Read
72 C30 sec
Read
Repeat Elongation 39 times
Termination95 C1 min
55 C1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C55 - 95 C30 sec
21 C10 min
End

Results:
Actin Amplification
Actin Melt Curve
 HSP70 Amplification
 HSP70 Melt Curve

The No template controls were clean and the amplification clear with good melt curves. Overall this looks really good. My next step is to test the new primers that came in today. I'll post tomorrow about what they look like.

You can see the raw qPCR data file here.

Tuesday, May 26, 2015

5 26 2015 Oly cDNA/Primer Check

Today I ran a qPCR using the Actin, HSP70, and Glutamine synthetase primers used by the 310 class on 6 cDNA samples prepared by Sam last week. You can read about it here. I made fresh working stocks from the original primer stocks. As per Sam's suggestion I diluted the cDNA to a 1:4 dilution to save on cDNA so I can run multiple primer checks.

Primer Working Stocks:

Actin
Ol_Act_FGACCAGCCAAATCCAGACGABC6/13/2012205560O.luridaActin, adductor muscle
Ol_Act_RCGGTCGTACCACTGGTATCG6/13/2012206060O.luridaActin, adductor muscle 

HSP70

HSP70_gigas_FGTTCCGATTTGTTCCGTGCCKK20C.gigasHSP70
HSP70_gigas_RTTGTCGCCATTTTCCTCGCTKK20C.gigasHSP70
Glutamine synthetase

Gluta_FATTCCCTCCCCTGATCCGTCCACCCAO.luridaGlutamine synthetase
Gluta_RTGGGTGGACGGATCAGGGGAGGGAATO.luridaGlutamine synthetase
Working Stock Calculations:
ul
Primer10
Nuclease free H2090
cDNA Dilution Calculations:
cDNA 1:4 Dilution
cDNA 10
Nuclease free H2030
Final Volume40
I then made up enough master mix to run 22 reactions. I miscalculated the number of no template controls (NTCs) I needed. I made too much master mix  for this run and will cut back on the next run.  
Master Mix Reagent Table:
VolumeReactions X12
Ssofast Evagreen MM 10220
FWD Primer0.511
REV Primer0.511
Nuclease Free H2O8176
cDNA1
To make each master mix, 3 total with one mix for each set of primers, I added the volumes from greatest to least of the reagents. 

Then I pipetted the master mixes into the plate followed by 1 ul of either water, positive control, or sample. I made duplicates of each sample to ensure the results. The positive control was from the NF31 Seed oyster DNA Isolation from 3/23/2015 with a concentration of 117.53 ng/ul. 

Plate Layout:
ActinActinHSP70HSP70GlutaGluta
789101112
C+NTCC+NTCC+NTC
NT1 NT1 NT1NT1NT1NT1
HT1HT1HT1HT1HT1HT1
ST1ST1ST1ST1ST1ST1
NC1NC1NC1NC1NC1NC1
HC1HC1HC1HC1HC1HC1
SC1SC1SC1SC1SC1SC1
NTCNTCNTCNTCNTCNTC
The results from the qPCR are below:
Actin Amp

Actin Melt Curve

HSP70 Amp

HSP70 Melt Curve

Glutamine Synthetase Amp

Glutamine Synthetase Melt Curve

Something was wrong with the Positive control which failed to amplify with two of the three primers. It also appears that glutamine synthetase indescriminately amplifies as it amplified in all three of the NTCs. Finally it appears that only 1 of the HSP samples amplified early than the controls. 

I can rerun this qPCR tomorrow with a better positive control but I believe the Actin and HSP70 primers still work well while the glutamine synthetase primer does not. I will begin running the new primers when they come in. 

You can see the raw qPCR data here.