6 23 2015 TLR2.1 qPCR

Yesterday after discovering that the Opticon was acting up, I decided to run a couple qPCR's on the Biorad CFX in the Friedman lab. The first was the TLR2.1 gene which had not been present in the Dabob population during the initial primer checks.

Primer:

1630	TLR2.1_FWD	ACAAAGATTCCACCCGGCAA	JH	5/21/2015	20	55		O.lurida	Toll-like receptor 2 type-1	Q9DD78
1629	TLR2.1_REV	ACACCAACGACAGGAAGTGG	JH	5/21/2015	20	55		O.lurida	Toll-like receptor 2 type-1	Q9DD78

Reagent Table:

	Volume	Reactions X58
Ssofast Evagreen MM	10	580
FWD Primer	0.5	29
REV Primer	0.5	29
Nuclease Free H2O	8	464
cDNA	1

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 19 ul Master Mix to each tube
5. Pipetted appropriate cDNA sample to each tube
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All Samples

NTCs

So the graph doesn't really do justice for the results. There is amplification in a majority of samples but interestingly only about half of the Dabob population shows expression of this allele. The other half show absolutely no expression. There are a few individuals which show a very low expression of this allele but others show some of the highest expression. Overall this is pretty confusing and may be indicative that the Dabob population is more heterogeneous for this allele than the other populations. After running this qPCR, I ran another Actin qPCR using the friedman machine to create a normalizing standard which I will talk about in my next post.

You can view the raw data here.

6 22 2015 Actin qPCR

Last night I ran a qPCR on Actin using the 48 cDNA samples produced by Sam. I ran it using the same procedure as I did for the CARM samples yesterday morning so that I can use it as a normalizing gene.

Primer Used:

1505	Ol_Act_F	GACCAGCCAAATCCAGACGA	BC	6/13/2012	20	55	60	O.lurida	Actin, adductor muscle
1504	Ol_Act_R	CGGTCGTACCACTGGTATCG		6/13/2012	20	60	60	O.lurida	Actin, adductor muscle

Master Mix Reagent Table:

	Volume	Reactions X58
Ssofast Evagreen MM	10	580
FWD Primer	0.5	29
REV Primer	0.5	29
Nuclease Free H2O	8	464
cDNA	1

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 19 ul Master Mix to each tube
5. Pipetted appropriate cDNA sample to each tube
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

qPCR Program:

Sybr New Plate+Sybr cDNA 60 melt 2 Read
Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

Amplification

 Melt Curve

As you can see the amplification and melt curves look good. Upon closer examination I did notice however that the rows at the top and bottom had much lower amplification than those in the middle. This is concerning as it could be giving me false values for samples in these spots. I've decided to forego using the Opticon and have now run samples on the BioRad in the Friedman lab in FSH. 

You can see the raw data file here.

6 22 2015 CARM1 qPCR

Today I ran a qPCR for CARM1 using cDNA created by Sam last week. On friday Steven got the initial run of sequenced samples to check that all populations produced the same sequence. He selected CARM1 as being the most similar with the other primers having one issue or another. I put together a qPCR plate with all the cDNA samples to see how CARM1 differs between populations and treatment/control.

Primer Used:

1642	CARM1_FWD	TGGTTATCAACAGCCCCGAC	JH	5/21/2015	20	55		O.lurida	Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)	Q6DC04
1641	CARM1_REV	GTTGTTGACCCCAGGAGGAG	JH	5/21/2015	20	55		O.lurida	Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)	Q6DC04

qPCR Master Mix Reagent Table:

	Volume	Reactions X55
Ssofast Evagreen MM	10	550
FWD Primer	0.5	27.5
REV Primer	0.5	27.5
Nuclease Free H2O	8	440
cDNA	1

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 19 ul Master Mix to each tube
5. Pipetted appropriate cDNA sample to each tube
1. Due to pipette error only 3 NTCs were run
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Sybr New Plate+Sybr cDNA 60 melt 2 Read
Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

HC1-8 Amplification

 HC1-8 Melt Curve

NC1-8 Amplification

 NC1-8 Melt Curve

SC1-8 Amplification

 SC1-8 Melt Curve

HT1-8 Amplification

 HT1-8 Melt Curve

NT1-8 Amplification

 NT1-8 Melt Curve

ST1-8 Amplification

 ST1-8 Melt Curve

NTC 1-3 Amplification

 NTC 1-3 Melt Curve

As you can see there is good amplification amoung all samples but without running the data through PCR Miner I can't distinguish a difference. Also there was some amplification in the NTC but it appears to be nonspecific with a much higher melting temp than the actual products. These high temp amplifiers don't appear in any of the other samples so I'm not worried about them as possible contamination. I've run a PCR on some more flanking primers to have them sequenced and am running a qPCR for Actin to see if we have similar results.

You can see the raw data file here.

5 29 2015 Designing Primers for Sequencing Target areas

Today after some conversations between Brent and Steven based on the previous primer checks (here and here) the idea arose that not all populations may share the same isoforms of the target genes. To determine if the genes are the same in all populations, its necessary to produce a sequence containing the primer region plus 100 bp on either side for sequencing in sub samples from each population. This put me in a unique situation. I needed to not only have the primer for the target gene, but also a primer that encompasses the target gene + original primer + 100 bp on either side of the sequence. I decided to use the NCBI Primer Blast, that I used to generate the original primers, to create the new primers.

First I need to figure out where in the sequence does the original primer amplify. To do this I have to upload the original sequence and the primer sequences into NCBI. For this I'm looking at the TLR2.1 primer since it has the most interesting results from the primer check.

The original primer sequences for TLR2.1:
FWD ACAAAGATTCCACCCGGCAA

REV  ACACCAACGACAGGAAGTGG

Product Size  109 bp

The original sequence for target gene:

tcaaaacagattttggagtgtaacgtctttaaaaattactaatacagcaacaatgaaatcattttgccatgaattgcttcacgatttgccagaacagcttctggccatttctattcattgtccactctacatgagatgctgacttgagaagcaccttcagagattgattaatatgttcagaacgaatatcttgtaatatgatcagcaatagcttgtcaccgcctccgtcagccaaagtgtggttggcaatggcggcttcgtacttacaccattgatcgtccaagaaattattggacagcaccaaaatgaattttctgctgacttcaatgctttccagaaagtcatccacaaagattccacccggcaagatatctctctcgtgcaaacaaagcttgtacttgtttctctctaccatctgaacaagttcagacattatccacttcctgtcgttggtgttgtaagcaacaaaaccatcatagaggaattcatcatctgtaaatcttttataccccatgggttttctgtttttgcatgtgtatatataatacttaatgtcccaacgaaactttctcaacagaacaatggtcaaaatcaccaaggacactaatgcaaacgaagcgcatactagaatgacataggggcttattttgtgacattcggacgcaggatcaaagtgtgttatactttttcctttcaagtctgacggggaagcacagatgtattgatgaggatatccaacagtcctattttggttgttttcaacccagagtcggaaccattccagttggcatccacagtccaatggattcaaggacacatcaattcgaaaatcttttttcttccaaaggaaagcaggcagagaagattcattgatactgctcaaacgattgccacgaaaaatcaattcattcaatctagtcaaattttgaacaccgctctttcgaatttctgttattcggttaacactgtagtcaacggacgttagctgtgaaaaatcagtcagtgtagtcatttgatcgatttcgccattaacaatagccaaaactgacagatcctttagaggtgatagcatctctgcaacatcagtgttggatagatcggtgttcattattttcaatgcttttatatttctacattcagaaaagatgtatttgaagcctcctacgcttttttccaccatacgtccgatagagagtgttcggagggaattggatgataatgacctaccatctaaagcgactccatgcaagttatcaatgatcaaagtttgcaaacgattcatattcaaaaaggaatacaaggaaatgtcatgaattgatgtgtgtgaaacattaaaaaattcaagggatttcaggcagtagccctcttgtatgaaatttgttgtttcccgaataccattcactgccaggtgcaattgttgcaagtttgggaaggcggctatacgtttctcattggataaacaaaactcgggaatcttctcaaaagaattgttagtaaaatacagttcttttaaagaaggaactgagctatttggcaatttataccttgagattaggttgcttcctaaatcgattttgtggatattgattaatttagcgaaggatttaaaag

First I run the sequence and the primers through NCBI Primer Blast:

Once the Primer Blast returns the primer target. I can then find where the primer begins and ends in the original sequence.

The forward primer begins at roughly 340 bp and the reverse primer begins at roughly 460 bp. Using these numbers I subtract 100 bp from the start of the forward primer and add 100 bp to the beginning of the reverse primer. This extends the range to 240 bp - 560 bp which encompasses the original target and primer area as well as 100 bp on either side. To give the Primer Blast some leeway to produce the new primers, I give a 100 bp range for the forward and reverse primers. The range for the forward primer becomes 140-240 bp. The range for the reverse primer becomes 560-660 bp. I also required the product size to be between 325 bp and 1000 bp long. This is so that the 100 bp on either side plus the 109 bp original target are amplified.

The primers that NCBI now covers the entire area that needs to be sequenced. All I have to do is choose primers that have low self complimentarity.

After looking at the offered primers I chose one that should give a 425 bp product with low self complimentarity.

This is the quickest way I've found to take the primers I produced originally and create primers to sequence the target area of interest. If this works I'll do this with all the primers of interest that worked in the previous primer runs.

5 28 2015 New Primer Check (13-23)

Today I completed the primer checks for the new primers. This run is less promising than yesterdays as it doesn't have any primers that show any real difference in them. There were more than a couple that failed in some manner.

To make the working stock of the primers.

1. 90 ul of Nuclease free (or Nanopure) H20 to 1.5 ml tube
2. 10 ul of Stock primers
3. Vortex briefly

I made these carefully in order to produce the following 12 pairs of primers. 

1626	HSP70c_FWD	AGGAAAGGTCGGGAGAGGAA	JH	5/21/2015	20	55		O.lurida	Heat shock 70 kDa protein 12A
1625	HSP70c_REV	ACCTCGGACTTTGGACGAAC	JH	5/21/2015	20	55		O.lurida	Heat shock 70 kDa protein 12A
1624	p29ING4_FWD	TACCTTTGGGCTTCACCGTC	JH	5/21/2015	20	55		O.lurida	Inhibitor of growth protein 4 (p29ING4)
1623	p29ING4_REV	GTCCATCACACACCCCTCAG	JH	5/21/2015	20	55		O.lurida	Inhibitor of growth protein 4 (p29ING4)
1622	CerS2_FWD	TTGTCGGTCTCCTCCTGCTA	JH	5/21/2015	20	55		O.lurida	Ceramide synthase 2 (CerS2) (LAG1 longevity assurance homolog 2)
1621	CerS2_REV	CCGTCTTCTGAGCCATCGTT	JH	5/21/2015	20	55		O.lurida	Ceramide synthase 2 (CerS2) (LAG1 longevity assurance homolog 2)
1620	GABABR1_FWD	CCGAGGAGGACACGAAACTC	JH	5/21/2015	20	55		O.lurida	Gamma-aminobutyric acid type B receptor subunit 1 (GABA-B receptor 1) (GABA-B-R1) (GABA-BR1) (GABABR1) (Gb1)
1619	GABABR1_REV	CGGACAGGTTCTGGATTCCG	JH	5/21/2015	20	55		O.lurida	Gamma-aminobutyric acid type B receptor subunit 1 (GABA-B receptor 1) (GABA-B-R1) (GABA-BR1) (GABABR1) (Gb1)
1618	HSP70d_FWD	TTTGTCTCACCGGCTTTGTG	JH	5/21/2015	20	55		O.lurida	Heat shock 70 kDa protein 6 (Heat shock 70 kDa protein B')
1617	HSP70d_REV	GACATGAGACCAAAGACGCC	JH	5/21/2015	20	55		O.lurida	Heat shock 70 kDa protein 6 (Heat shock 70 kDa protein B')
1616	THRa_FWD	GACACTATCCTCACTCGGCG	JH	5/21/2015	20	55		O.lurida	Thyroid hormone receptor alpha (Nuclear receptor subfamily 1 group A member 1)
1615	THRa_REV	GGGTGCCGAGTAAACAAGGA	JH	5/21/2015	20	55		O.lurida	Thyroid hormone receptor alpha (Nuclear receptor subfamily 1 group A member 1)
1614	Defensin_FWD	TCTAGCGGAGTTTGTTGGGG	JH	5/21/2015	20	55		O.lurida	Big defensin
1613	Defensin_REV	ATGGCTGTCGGAGGAGGATT	JH	5/21/2015	20	55		O.lurida	Big defensin
1612	GRB2_FWD	AACTTTGTCCACCCAGACGG	JH	5/21/2015	20	55		O.lurida	Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2)
1611	GRB2_REV	CCAGTTGCAGTCCACTTCCT	JH	5/21/2015	20	55		O.lurida	Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2)
1610	H3.3_FWD	CACGCTCTCCTCGAATCCTC	JH	5/21/2015	20	55		O.lurida	Histone H3.3
1609	H3.3_REV	AAGTTGCCTTTCCAGCGTCT	JH	5/21/2015	20	55		O.lurida	Histone H3.3
1608	H2A.V_FWD	TGCTTTCTGTGTGCCCTTCT	JH	5/21/2015	20	55		O.lurida	Histone H2A.V (H2A.F/Z) (Fragment)
1607	H2A.V_REV	TATCACACCCCGTCACTTGC	JH	5/21/2015	20	55		O.lurida	Histone H2A.V (H2A.F/Z) (Fragment)
1606	H2A_FWD	GCTGGGGTTTTTCTGGGTCT	JH	5/21/2015	20	55		O.lurida	Histone H2A
1605	H2A_REV	GGAACTACGCCGAGAGAGTG	JH	5/21/2015	20	55		O.lurida	Histone H2A

After producing the working stocks I then made a 10 reaction master mix. 

Master Mix reagent table

	Volume	Reactions X10
Ssofast Evagreen MM	10	100
FWD Primer	0.5	5
REV Primer	0.5	5
Nanopure H2O	8	80
cDNA	1

Protocol:

1. Added Ssofast to each of 12 tubes
2. Added Nanopure water to each of 12 tubes
3. Carefully added FWD primer, then Reverse primer to the appropriate tube
4. Vortex briefly
5. One Master Mix used per column in plate
6. Pipette 19 ul of master mix to each well for the appropriate column
7. Either No Template Control (NTC) or sample for each Row in the plate
8. 1 ul Sample/NTC per well in the appropriate row

Table Layout:

HSP70c	P29ING	CerS2	GABABR	HSP70d	THRa	Defensin	GRB2	H3.3	H2A.V	H2A
1	2	3	4	5	6	7	8	9	10	11	12
NTC	NTC	NTC	NTC	NTC	NTC	NTC	NTC	NTC	NTC	NTC
NT1	NT1	NT1	NT1	NT1	NT1	NT1	NT1	NT1	NT1	NT1
HT1	HT1	HT1	HT1	HT1	HT1	HT1	HT1	HT1	HT1	HT1
ST1	ST1	ST1	ST1	ST1	ST1	ST1	ST1	ST1	ST1	ST1
NC1	NC1	NC1	NC1	NC1	NC1	NC1	NC1	NC1	NC1	NC1
HC1	HC1	HC1	HC1	HC1	HC1	HC1	HC1	HC1	HC1	HC1
SC1	SC1	SC1	SC1	SC1	SC1	SC1	SC1	SC1	SC1	SC1
NTC	NTC	NTC	NTC	NTC	NTC	NTC	NTC	NTC	NTC	NTC

qPCR Program:

Sybr New Plate+Sybr cDNA 60 melt 2 Read
Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	55 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Results:

HSP70c Amplification

 HSP70c Melt Curve

p29ING Amplification

 p29ING Melt Curve

CerS2 Amplification

 CerS2 Melt Curve

GABABR Amplification

 GABABR Melt Curve

HSP70d Amplification

 HSP70d Melt Curve

THRa Amplification

 THRa Melt Curve

Defensin Amplification

 Defensin Melt Curve

GRB2 Amplification

 GRB2 Melt Curve

H3.3 Amplification

 H3.3 Melt Curve

H2A.V Amplification

 H2A.V Melt Curve

H2A Amplification

 H2A Melt Curve

Posted below are assumptions based on the very limited data from this check. It is only being produced to eliminate useless primers from future tests and highlight possibly interesting primers. Only with further testing will we be able to determine true trends. 

CerS2, HSP70d, THRa, and Defensin failed due to no amplification or poor melt curve conditions. 

HSP70c produced a weird bump inline with the other melt curves. This primer should probably not be used due to the inability to eliminate this issue.

H3.3, H2A.V, and H2A all showed similar results with H2A being very similar in all samples. These could be candidates for normalizing genes to use with Actin. 

p29ING also appeared to have uniform expression in all samples. This could also be another normalizing gene.

GABABR appeared to have down regulation in Heat Stress for Fidalgo and Dabob but there's no way to tell unless we run more replicates. 

GRB2 had some variable expression between heat shock and control samples but we'll need to run further tests to ensure this. 

Tomorrow I should finalize a list of the primers of interest.  Hopefully next week I'll be able to run them with a full complement of samples and normalizing genes. 

You can find the raw qPCR data here.