Showing posts with label qPCR. Show all posts
Showing posts with label qPCR. Show all posts

Monday, July 27, 2015

7 24 2015 H2A.V qPCR 2

Today I ran duplicates for the targets I ran last week. I'm hoping to get strong replicates for analysis. Here I ran the H2A.V which last week had issues with the NTC. 

Primers:


1608H2A.V_FWDTGCTTTCTGTGTGCCCTTCTJH5/21/20152055O.luridaHistone H2A.V (H2A.F/Z) (Fragment)P08991
1607H2A.V_REVTATCACACCCCGTCACTTGCJH5/21/20152055O.luridaHistone H2A.V (H2A.F/Z) (Fragment)P08991

Reagent Table:
VolumeReactions X116
Ssofast Evagreen MM101160
FWD Primer0.558
REV Primer0.558
1:9 cDNA9
  1. Added reagents from greatest to least volume
  2. Vortexed
  3. Centrifuged briefly
  4. Pipetted 11 ul Master Mix to each tube
  5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
  6. Centrifuged plate at 2000 rpm for 1 minute
  7. Ran Program Below
Program:
StepTemperatureTime
Initiation95 C10 min
Elongation95 C30 sec
60 C1 min
Read
72 C30 sec
Read
Repeat Elongation 39 times
Termination95 C1 min
55 C1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C55 - 95 C30 sec
21 C10 min
End
Plate Layout:
1234567
DNased 42215 HC1DNased 42215 NC1DNased 42215 SC1DNased 42215 HT1 1DNased 42215 NT1 1DNased 42215 ST1 1NTC
DNased 42215 HC2DNased 42215 NC2DNased 42215 SC2DNased 42215 HT1 2DNased 42215 NT1 2DNased 42215 ST1 2NTC
DNased 42215 HC3DNased 42215 NC3DNased 42215 SC3DNased 42215 HT1 3DNased 42215 NT1 3DNased 42215 ST1 3NTC
DNased 42215 HC4DNased 42215 NC4DNased 42215 SC4DNased 42215 HT1 4DNased 42215 NT1 4DNased 42215 ST1 4NTC
DNased 42215 HC5DNased 42215 NC5DNased 42215 SC5DNased 42215 HT1 5DNased 42215 NT1 5DNased 42215 ST1 5
DNased 42215 HC6DNased 42215 NC6DNased 42215 SC6DNased 42215 HT1 6DNased 42215 NT1 6DNased 42215 ST1 6
DNased 42215 HC7DNased 42215 NC7DNased 42215 SC7DNased 42215 HT1 7DNased 42215 NT1 7DNased 42215 ST1 7
DNased 42215 HC8DNased 42215 NC8DNased 42215 SC8DNased 42215 HT1 8DNased 42215 NT1 8DNased 42215 ST1 8
Results:

All samples
NTCs

The amplification curves look good. There's absolutely no amplification in the NTCs. 

Now I have to compare the replicates Ct values to see how close they resemble each other. 


These replicates are pretty close together with most between 0.5 and 1.5 Cts different. 


These look pretty good and would work better if averaged together.

You can see the raw data here.

7 24 2015 p29ING qPCR 2

Today I ran duplicates for the targets I ran last week. I'm hoping to get strong replicates for analysis. Here I ran the GRB2 which last week had issues with the NTC. 

Primers:

1624p29ING4_FWDTACCTTTGGGCTTCACCGTCJH5/21/20152055O.luridaInhibitor of growth protein 4 (p29ING4)Q8C0D7
1623p29ING4_REVGTCCATCACACACCCCTCAGJH5/21/20152055O.luridaInhibitor of growth protein 4 (p29ING4)Q8C0D7


Reagent Table:
VolumeReactions X116
Ssofast Evagreen MM101160
FWD Primer0.558
REV Primer0.558
1:9 cDNA9
  1. Added reagents from greatest to least volume
  2. Vortexed
  3. Centrifuged briefly
  4. Pipetted 11 ul Master Mix to each tube
  5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
  6. Centrifuged plate at 2000 rpm for 1 minute
  7. Ran Program Below
Program:
StepTemperatureTime
Initiation95 C10 min
Elongation95 C30 sec
60 C1 min
Read
72 C30 sec
Read
Repeat Elongation 39 times
Termination95 C1 min
55 C1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C55 - 95 C30 sec
21 C10 min
End
Plate Layout:
1234567
DNased 42215 HC1DNased 42215 NC1DNased 42215 SC1DNased 42215 HT1 1DNased 42215 NT1 1DNased 42215 ST1 1NTC
DNased 42215 HC2DNased 42215 NC2DNased 42215 SC2DNased 42215 HT1 2DNased 42215 NT1 2DNased 42215 ST1 2NTC
DNased 42215 HC3DNased 42215 NC3DNased 42215 SC3DNased 42215 HT1 3DNased 42215 NT1 3DNased 42215 ST1 3NTC
DNased 42215 HC4DNased 42215 NC4DNased 42215 SC4DNased 42215 HT1 4DNased 42215 NT1 4DNased 42215 ST1 4NTC
DNased 42215 HC5DNased 42215 NC5DNased 42215 SC5DNased 42215 HT1 5DNased 42215 NT1 5DNased 42215 ST1 5
DNased 42215 HC6DNased 42215 NC6DNased 42215 SC6DNased 42215 HT1 6DNased 42215 NT1 6DNased 42215 ST1 6
DNased 42215 HC7DNased 42215 NC7DNased 42215 SC7DNased 42215 HT1 7DNased 42215 NT1 7DNased 42215 ST1 7
DNased 42215 HC8DNased 42215 NC8DNased 42215 SC8DNased 42215 HT1 8DNased 42215 NT1 8DNased 42215 ST1 8
Results:

All samples
Amp
Melt Curve
NTCs
Amp
Melt Curve

The amplification curves look good. There's no amplification in the NTCs. Now I need to confirm the Ct values align with the previous replicate. 


To get the reps closer together I ran the opticon correction. 


The reps look okay. They don't perfectly align and there's more errors in the Opticon run than the CFX run. 

You can see the raw data here.

7 24 2015 HSP70 qPCR 2

Today I ran duplicates for the targets I ran last week. I'm hoping to get strong replicates for analysis. Here I ran the HSP70 which last week had issues with the NTC. 

Primers:

HSP70 
FWD - TTGTCGCCATTTTCCTCGCT
REV - GTTCCGATTTGTTCCGTGCC



Reagent Table:
VolumeReactions X116
Ssofast Evagreen MM101160
FWD Primer0.558
REV Primer0.558
1:9 cDNA9
  1. Added reagents from greatest to least volume
  2. Vortexed
  3. Centrifuged briefly
  4. Pipetted 11 ul Master Mix to each tube
  5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
  6. Centrifuged plate at 2000 rpm for 1 minute
  7. Ran Program Below
Program:
StepTemperatureTime
Initiation95 C10 min
Elongation95 C30 sec
60 C1 min
Read
72 C30 sec
Read
Repeat Elongation 39 times
Termination95 C1 min
55 C1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C55 - 95 C30 sec
21 C10 min
End
Plate Layout:
1234567
DNased 42215 HC1DNased 42215 NC1DNased 42215 SC1DNased 42215 HT1 1DNased 42215 NT1 1DNased 42215 ST1 1NTC
DNased 42215 HC2DNased 42215 NC2DNased 42215 SC2DNased 42215 HT1 2DNased 42215 NT1 2DNased 42215 ST1 2NTC
DNased 42215 HC3DNased 42215 NC3DNased 42215 SC3DNased 42215 HT1 3DNased 42215 NT1 3DNased 42215 ST1 3NTC
DNased 42215 HC4DNased 42215 NC4DNased 42215 SC4DNased 42215 HT1 4DNased 42215 NT1 4DNased 42215 ST1 4NTC
DNased 42215 HC5DNased 42215 NC5DNased 42215 SC5DNased 42215 HT1 5DNased 42215 NT1 5DNased 42215 ST1 5
DNased 42215 HC6DNased 42215 NC6DNased 42215 SC6DNased 42215 HT1 6DNased 42215 NT1 6DNased 42215 ST1 6
DNased 42215 HC7DNased 42215 NC7DNased 42215 SC7DNased 42215 HT1 7DNased 42215 NT1 7DNased 42215 ST1 7
DNased 42215 HC8DNased 42215 NC8DNased 42215 SC8DNased 42215 HT1 8DNased 42215 NT1 8DNased 42215 ST1 8
Results:

All samples
Amp
Melt Curve
NTCs
Amp
Melt Curve

The amplification curves look good. There's no amplification in the NTCs. 
I need to compare the Ct values to ensure that they are similar between the two runs. 


To fix the difference I ran the opticon correction on it.


With correction the data looks better though there are several non amplifying samples in the opticon run. 

You can see the raw data here.