I ran this PCR a couple of times before and, embarrassingly, I had ordered/used the wrong primers.

Well, I ordered the correct universal cytochrome oxidase primers and used those!

SR ID	Primer Name	Sequence
1739	HC02198	taaacttcagggtgaccaaaaaatca
1738	LCO1490	ggtcaacaaatcataaagatattgg
1736	COCsi546r	AAGTAACCTTAATAGATCAGGGAACC
1735	COCgi269r	TCGAGGAAATTGCATGTCTGCTACAA

Primers and cycling parameters were taken from this publication:

• Haiyan Wang and Ximing Guo “Identification of Crassostrea ariakensis and Related Oysters by Multiplex Species-Specific PCR,” Journal of Shellfish Research 27(3), 481-487, (1 May 2008).

Universal cytochrome oxidase primers were from this paper:

• Folmer, O., M. Black, W. Hoeh, R. Lutz & R. Vrijenhoek. 1994. DNA primers for amplification of mitochondrial cytochrome C oxidase subunit I from diverse metazoan invertebrate. Mol. Mar. Biol. Biotechnol. 3:294–299.

This is a multiplex PCR, where the HC02198 and LCO1490 primers should amplify any Crassostrea spp. DNA (i.e. a positive control - 697bp) and the other two primers will amplify either C.gigas (Cgi269r - 269bp) or C.sikamea (Csi546r - 546bp).

Master mix calcs:

Component	Single Rxn Vol. (uL)	Num. Rxns	Total Volumes (uL)
DNA	4	NA	NA
2x Apex Master Mix	12.5	18	225
HC02198 (100uM)	0.15	18	2.7
LCO1490 (100uM)	0.15	18	2.7
COCgi269r (100uM)	0.1	18	1.8
COCsi546r (100uM)	0.1	18	1.8
H2O	8	18	144
	25		Add 21uL to each PCR tube

Cycling params:

95^oC for 10mins

30 cycles of:

• 95^oC 1min
• 51^oC 1min
• 72^oC 1min

72^oC 10mins

PCR reactions were run on a 1.5% agarose, 1x low TAE gel with ethidium bromide.

Used the GeneRuler DNA Ladder Mix (ThermoFisher) for all gels:

---

RESULTS

Alrighty, this is what we expected to see (at least in terms of primer functionality). We see:

• A band of ~700bp in all samples (i.e. the universal cytochrome oxidase primers)

• A band of ~270bp in theC.gigas 1911SS samples

Now, this is where things get interesting…

In the C.sikamea CA5SS:

• A prominent band of ~550bp, indicating these are C.sikamea

• A less prominent, but definitive, band at ~270bp, indicating the presence of C.gigas cytochrome oxidase sequence. Suggests that this particular stock has hybridized with C.gigas (or, there was some sort of cross contamination of DNA/tissue; unlikely as we don’t see potential cross contamination of C.sikamea DNA in the other samples).

In the C.sikamea 1911SS:

• A prominent band of ~270bp, indicating these are C.gigas, despite the bag label indicating them as Kumamoto and/or Pacific oysters (see image below)