A quick tutorial to check out primers on NCBI to see what the product size should be and how specific they are.
Primer Name- CCGS4F Primer Sequence- TATTCGTTGGAGACTTTATAACCCT Resource: Patil et al. 2005 Primer Name- CCGS4R Primer Sequence- AAGGCTTAGAATTGCAAGGTCTATA Resource: Patil et al. 2005 Primer Name- TPHI16S-1F Primer Sequence- CTGAGTTTTTAATTGAAGTT TAGTTGGG Resource: Quinteiro et al. 2011 Primer Name- TPHI16S-2R Primer Sequence- CCCTGCGGTAGC TTTTGCT Resource: Quinteiro et al. 2011
Old school way is just take the primer with NNNs in the middle and blast.
TATTCGTTGGAGACTTTATAACCCTNNNNNNNNNNNNNNNNNNNNNAAGGCTTAGAATTGCAAGGTCTATA
You will get an output as such….
Scroll down to the alignments….
And look at the coordinates….
So the primers lay down between bp 400 and 61 on the given sequence, thus 400-61=339 and the band size should be about 339 bp.
You could also just use the Primer-Blast feature.
Bonus! It does the math for you!
Recent Comments