Tag Archives: RAD-seq

RAD-Seq Library Prep Reagents

A box with the above title was established in the -20C in FTR 209 containing the following:

  • Thermo Scientific AlfI: ER1801
  • NEB T4 DNA ligase, 50 μL: M0202S
  • NEB 10 mM ATP, 1 mL: P0756S
  • Promega dNTPs (10 mM each): U1511
  • NEB Q5 Taq Polymerase, 100 units: M0491S

Oligos (100μL each in TE pH=8.0; barcode sequences are in bold)

Adaptor 1
5ILL-NR: CTACACGACGCTCTTCCGATCTNR

Anti-ILL: AGATCGGAAGAGC(InvdT)

Adaptor 2
3ILL-NR: CAGACGTGTGCTCTTCCGATCTNR

ILL-Lib1: AATGATACGGCGACCACCGA

ILL-Lib2: CAAGCAGAAGACGGCATACGA

ILL-HT1: AATGATACGGCGACCACCGAGATCTACACATGCATACACTCTTTCCCTACACGACGCTCTTCCGATCT

ILL-HT2:AATGATACGGCGACCACCGAGATCTACACCGTACGACACTCTTTCCCTACACGACGCTCTTCCGATCT

ILL-BC1: CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

RAD Sequencing – Oly Oyster gDNA-01 RAD Library (from 20141110)

Prepared 10nM of the library in total volume of 20uL of Buffer EB (Qiagen) + 0.1% Tween-20, according the University of Oregon’s Genomic’s Core:

http://gcf.uoregon.edu/home/services

Based on a calculator provided by their site, 10nM was equivalent to 2.93ng/uL. Diluted 3.13uL of the library (18.7ng/uL) in 16.87uL of Buffer EB + Tween 20.

Shipped FedEx Standard Overnight on wet ice for 100bp single end Illumina sequencing.

DNA Quantification – Oly Oyster gDNA-01 RAD Library

Quantified the library using the Quant-It BR Kit (Life Technologies) according to the manufacturer’s protocol. Only used 1uL of the RAD library due to the small volume (15uL).

RAD library concentration (ng/uL): 18.688

Need to submit 5nM of the library for sequencing.

Average size = ~500bp (400bp extracted from gel + 100bp of adapters)

Molar concentration of the RAD library is 56.63nM.

Calcs are here: 20141110 – Oly Oyster gDNA-01 RAD Library Calcs

Library Prep – Oly Oyster gDNA-01 RAD

Used gel-purified, size-selected DNA from yesterday to prepare the RAD library using the Kappa LTP Kit:

http://eagle.fish.washington.edu/trilobite/Sites_genefish_100112/Steven/Commercial%20Protocols/KAPA_Biosystems%20-%20KAPA_LTP_Library_Preparation_Kit_TDS.pdf

The protocol was followed with the following changes:

– Section 8

Skipped entirely

– Section 9.1

Used 10uL of library DNA (instead of 20uL)

Used 1uL of mixed primer set (instead of 5uL)

– Section 9.2

Performed 12 cycles of PCR protocol. This was Carita’s recommendation and experience with using the Kappa LTP Kit for RAD library construction.

Sample was eluted from the AMPure beads with 15uL of Buffer EB (Qiagen) and stored @ -20C.

DNA Shearing & Size Selection – Oly Oyster gDNA RAD P1 Adapters (from 20141105)

Pooled “low quality” samples and pooled “high quality” samples separately (in 1.5mL snap cap tubes) prior to shearing to improve chances of getting similar DNA size ranges.

Samples were selected based on the gels run by Steven on Oct. 17, 2014: http://sr320.tumblr.com/

Low quality samples (5uL from each):

All rows, columns 1 -9

Higher quality samples (5uL from each):

All rows, columns 10 -12

Sheared each samples with the following cycling protocols on the Biorupter Plus (Diagenode):

Low

  • 3 cycles of:
  • 30 seconds on
  • 59 seconds off

 

High

4 cycles of:

  • 30 seconds on
  • 59 seconds off

 

Ran a subset of sheared gDNA (5uL from each pool) on gel to verify final size range:

Gel loading:

Lane 1 – O’GeneRuler 100bp Ladder (ThermoFisher)

Lane 2 – Low quality

Lane 3 – Higher quality

I neglected to run a set of un-sheared DNA.

Both samples appear to have an average size of 200 – 400bp.

After confirming satisfactory shearing, the two samples were combined and run on a 1% agarose low TAE gel (stained with EtBr) for size selection.

O’GeneRuler 100bp Ladder (ThermoFisher)

O’GeneRuler 100bp Ladder (ThermoFisher)

Size range of sheared DNA from 300 – 500bp was excised from gel.

 

Gel fragment weighed 254mg.

Purified using MiniElute Gel Extraction Kit (Qiagen).

Added three volumes (762uL) of Buffer QG to gel slice.

Incubated ~10mins on rotator until gel slice was fully dissolved.

Added one gel slice volume (254uL) of isopropanol; inverted multiple times to mix.

Added 700uL to MiniElute column; spun max speed (~16,000g) 1min; discarded flow-through.

Added remainder of sample to MiniElute column; spun max speed (~16,000g) 1min; discarded flow-through.

Added 500uL of Buffer QG to MiniElute column; spun max speed (~16,000g) 1min; discarded flow-through.

Added 750uL of Buffer PE to MiniElute column; incubated @ RT for 5mins; spun max speed (~16,000g) 1min; discarded flow-through.

Spun MinElute column spun max speed (~16,000g) 1min; transferred column to clean 2.0mL tube.

Added 50uL of Buffer EB to column, incubated @ RT for 5mins and spun max speed (~16,000g) 1min; discarded column.

Stored sample @ 4C.

Ligation – Illumina P1 Adapters for Oly Oyster gDNA-01 RAD Sequencing (from 20141031)

Made 25nM working stock from the 100nM stock adapter plate provided by Carita. Added 2uL of each adapter to corresponding well of SbfI digested DNA (e.g. DNA plate well A1 got the P1 adapter from well A1 in the adapter plate).

Created master mix of the ligation components and added 3uL to each well of SbfI-digested Oly gDNA.

Master mix calcs are here: 20141105 – Oly Oyster gDNA-01 Adapter Ligation

Incubated @20C for 60mins. Deactivated ligase @65C for 30mins. Stored @ 4C.

Adapter plate layout and sequences can be found here: 96_SbfI_RAD_adapter_sequences

Restriction Digest – Oly Oyster gDNA-01 for RAD Sequencing (from 20141029)

Samples required two days of drying for all samples to fully dry down.

Reconstituted all samples in 20uL of PCR H2O.

Performed restriction digests:

Incubated at 37C for 90mins and then inactivated enzyme @ 80C for 20mins. Incubation was done in thermal cycler using heated lid. Plate was stored @ -20C.

DNA Quantification – Oly Oyster gDNA-01 for RAD Sequencing (from 20141014)

Quantified the gDNA isolated 20141014 using the Quant-iT dsDNA Broad Range kit (Life Technologies).

Used half the recommended volume of buffer (100uL instead of 200uL), as well as half the recommended volume of dye (5uL instead of 10uL). Prepared a master mix of the buffer/dye solution, containing a 1:200 dilution of the dye:

Buffer: 14745uL

Dye: 75

100uL of the solution was added to the appropriate wells in two 96 well, black plates with a multichannel pipette.

5uL of each standard was added to the designated wells (see the plate layout in the Results below). Standards were run in duplicate.

5uL of each samples was added to the designated wells.

Samples were quantified using a plate reader.

Results:

Raw fluorescence was collected and an equation for the standard curve was determined for each plate. Concentrations were calculated from that equation (see linked spreadsheet below).

Concentrations of each sample in their corresponding locations in the Oly Oyster gDNA-01 plate are here: 20141022-OlyRADdnaConcentrations

Additionally, the volumes needed for 500ng of each sample the required starting amount for the RAD sequencing protocol) are also on the spreadsheet linked above.

DNA Isolation – Olympia Oyster Populations for RAD Sequencing

Olympia oysters from three different Puget Sound locations/populations (HL, NF, and SN) were collected and stored @ -80C on 8/29/2103.

We removed whole bodies from 32 oysters (randomly selected; ~5 -10mm “diameter” shells) from each population and placed them into a 96 well DNeasy Blood & Tissue Kit (Qiagen). DNA was prepared/isolated according to the manufacturer’s protocol.

DNA was eluted once with 200uL of Buffer AE and stored @ 4C.

Plate is called: Oly Oyster gDNA-01

Plate layout can be found here: 20141022-OlyRADdnaConcentrations

UPDATE 20141017

Steven ran the samples out on a gel for quality assessment. His notebook entry can be seen here:

Gel layout info and image of gel 1 of 2: http://sr320.tumblr.com/post/100245499294

Images of gel 2 of 2: http://sr320.tumblr.com/post/100231194034

The samples are all heavily smeared, suggesting heavy degradation. Will compare Qiagen kit with DNazol on some of the samples from 8/29/2013, as well as samples more recently collected/frozen.