Prepared the RNA Pico 6000 ladder (Agilent) according to the manufacturer’s protocol:
Made 2μL aliquots of the ladder in 0.5mL snap cap tubes. Samples were boxed, labeled, and stored @ -80C (Rack #9).
Continuing with the RAD-seq library prep. Following the Meyer Lab 2bRAD protocol.
Prior to generating full-blown libraries, we need to run a “test-scale” PCR to identify the minimum number of cycles needed to produce the intended product size (166bp).
I ran PCR reactions on a subset (Sample #: 4, 7, 14, & 30) of the 10 samples that I performed adaptor ligations on earlier today.
All components were stored on ice.
dNTPs – 1mM working stock was made
ILL-LIB1 & 2 – 10μM working stocks were made
ILL-HT1 & 2 – 1μM working stocks were made
ILL-BC1 – 1μM working stock was made
PCR reactions were set up on ice in 0.5mL PCR tubes.
| REAGENT | SINGLE REACTION (μL) | x4.4 |
| Template | 8 | NA |
| NanoPure H2O | 1 | 4.4 |
| dNTPs (1mM) | 4 | 17.6 |
| ILL-LIB1 (10μM) | 0.4 | 1.76 |
| ILL-LIB2 (10μM) | 0.4 | 1.76 |
| ILL-HT1 (1μM) | 1 | 4.4 |
| ILL-BC1 (1μM) | 1 | 4.4 |
| 5x Q5 Reaction Buffer | 4 | 17.6 |
| Q5 DNA Polymerase | 0.2 | 0.88 |
| TOTAL | 20 | 52.8 |
Combined 12μL of master mix with 8μL of the ligation reaction from earlier today.
Cycling was performed on a PTC-200 (MJ Research) with a heated lid:
| STEP | TEMP (C) | TIME (s) |
| Initial Denaturation |
|
|
| 27 cycles |
|
|
We’re following the “1/4 reduced representation” aspect of the protocol. As such, 5μL of each reaction was pulled immediately after the extension (72C – machine was paused) of cycles 12, 17, 22, & 27 in order to determine the ideal number of cycles to use. Also ran the ligation reactions (labelled “Digests” on the gel below) of two samples (samples #: 4 & 7) as a pre-PCR comparison.
These samples were run on a 1x modified TAE 2% agarose gel (w/EtBr).
Results:
The results aren’t great. No band(s) visible in any samples at even the highest cycle number (27 cycles). Although, if you squint pretty hard, an extremely faint band might be visible in between the 100/200bp markers in the 27 cycles group.
Regardless, the PCRs will need to be repeated with an increased number of cycles. This is not terribly surprising, as the Meyer Lab protocol indicates that degraded samples will likely need a greater number of cycles than what they recommend and that cycle number will have to be determined empirically.
Yesterday’s AlfI over night restriction digest was heat inactivated by heating @ 65C for 10mins. Samples were stored on ice.
Continued to follow the 2bRAD protocol (PDF) developed by Eli Meyer’s lab.
Digested DNA was not run out on a gel due to the fact that the input gDNA was degraded and a shift in the high molecular weight band (indicating the digestion was successful) would not exist because a high molecular weight band is absent in these samples.
The following oligos were reconstituted in TE buffer (pH = 8.0) to 100μM:
After preparing the two adaptors below, they were incubated for 10mins @ RT:
After annealing, the adaptors were stored on ice.
All components were stored on ice. Ligation reactions were prepared on ice and performed in 0.5mL snap cap tubes.
| REAGENT | SINGLE REACTION (μL) | x11 |
| Digested DNA | 10 | NA |
| ATP (10mM) | 1 | 11 |
| 10x T4 Ligase Buffer | 4 | 44 |
| Adaptor 1 (2μM) | 5 | 55 |
| Adaptor 2 (2μM) | 5 | 55 |
| T4 DNA Ligase | 1 | 11 |
| NanoPure H2O | 24 | 264 |
| TOTAL | 50 | 440 |
Added 40μL of the master mix to each tube of AlfI-digested DNA (12μL). NOTE: I made a mistake here. I should have only combined 10μL of DNA with the 40μL of master mix for each. My mistake was due, in part, to the way the Meyer Lab 2bRAD protocol is written. In the Digestion section of the protocol, Step 5 (run 2μL of the digests on a gel) is listed as optional. However, in Step 2a of the Ligation section, it says to add the “remaining 10μL of digested DNA”. The use of the word “remaining” in this instance is misleading because it implies to use all that’s left in the tube.
Incubated ligation reaction @ 16C for 3hrs in PTC-200 thermal cycler (MJ Research) – no heated lid.
Transferred tubes to ice while preparing subsequent
Used a subset (10 samples) from the Ostrea lurida gDNA isolated 20150916 to prepare RAD libraries. This will be done to assess whether or not these samples, which appear to be heavily degraded, are viable for RAD-seq.
Followed the 2bRAD protocol (PDF) developed by Eli Meyer’s lab.
Prepared 1.2μg of each of the following samples in a volume of 10μL:
Google Sheet: 20150930_RADseq_DNA_calcs
Prepared a 150μM working stock of the SAM buffer needed for the restriction digestion by diluting 30μL of the supplied stock (500μM) in 70μL NanoPure H2O (total volume = 100μL). This working stock was stored @ -20C in FTR 209 in the “RAD-seq Reagents” box.
Prepared master mix for restriction enzyme reaction:
| REAGENT | SINGLE REACTION (μL) | x11 |
| DNA | 8 | NA |
| 10x Buffer R | 1.2μL | 13.2μL |
| 150μM SAM | 0.8μL | 8.8μL |
| AlfI | 0.5μL | 5.5μL |
| H2O | 1.5μL | 16.5μL |
Combined 4μL of the master mix with 8μL of each sample in 0.5mL snap cap tubes. Incubated @ 37C O/N in thermal cycler (no heated lid).
A box with the above title was established in the -20C in FTR 209 containing the following:
Oligos (100μL each in TE pH=8.0; barcode sequences are in bold)
Adaptor 1
5ILL-NR: CTACACGACGCTCTTCCGATCTNR
Anti-ILL: AGATCGGAAGAGC(InvdT)
Adaptor 2
3ILL-NR: CAGACGTGTGCTCTTCCGATCTNR
ILL-Lib1: AATGATACGGCGACCACCGA
ILL-Lib2: CAAGCAGAAGACGGCATACGA
ILL-HT1: AATGATACGGCGACCACCGAGATCTACACATGCATACACTCTTTCCCTACACGACGCTCTTCCGATCT
ILL-HT2:AATGATACGGCGACCACCGAGATCTACACCGTACGACACTCTTTCCCTACACGACGCTCTTCCGATCT
ILL-BC1: CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
Prepared sterile, ~1.5mL aliquots of SsoFast EvaGreen Supermix (received 20150810) in 2.0mL screw cap tubes. All aliquots were dated and stored @ -20C in the “PCR Supplies” box.
BioRad Lot#: 730003517
Prepared sterile, 1.0mL aliquots of SsoFast EvaGreen Supermix (received today) in 2.0mL screw cap tubes. All aliquots were dated and stored @ -20C in the “PCR Supplies” box.
BioRad Lot#: 730003517